Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pK RagA-RagC
(Plasmid #99649)


Item Catalog # Description Quantity Price (USD)
Plasmid 99649 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Entrez Gene
    RRAGA (a.k.a. FIP-1, FIP1, RAGA)
  • Promoter T7
  • Tags / Fusion Proteins
    • 10x His tag (N terminal on backbone)
    • Poly arginine linker (N terminal on backbone)
    • SUMO (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GACCCCTGAAGATTTGGACATGG
  • 3′ sequencing primer CGATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Entrez Gene
    RRAGC (a.k.a. GTR2, RAGC, TIB929)
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTGTACACGGCCGCATAATCG
  • 3′ sequencing primer CAAGACCCGTTTAGAGGCCCCAAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pK RagA-RagC was a gift from David Sabatini & Kuang Shen (Addgene plasmid # 99649 ; ; RRID:Addgene_99649)
  • For your References section:

    Intersubunit Crosstalk in the Rag GTPase Heterodimer Enables mTORC1 to Respond Rapidly to Amino Acid Availability. Shen K, Choe A, Sabatini DM. Mol Cell. 2017 Oct 17. pii: S1097-2765(17)30704-9. doi: 10.1016/j.molcel.2017.09.026. 10.1016/j.molcel.2017.09.026 PubMed 29056322