pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
(Plasmid
#99690)
-
PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAV
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99690 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV (pUC f1)
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG )
-
SpeciesM. musculus (mouse), Synthetic
-
Mutationdead Cas9
-
Entrez GeneActc1 (a.k.a. Actc-1)
-
Tag
/ Fusion Protein
- VPR mini (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/298620 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1 was a gift from George Church (Addgene plasmid # 99690 ; http://n2t.net/addgene:99690 ; RRID:Addgene_99690) -
For your References section:
Rational design of a compact CRISPR-Cas9 activator for AAV-mediated delivery. Vora S, Cheng J, Xiao R, VanDusen NJ, Quintino L, Pu WT, Vandenberghe LH, Chavez A, Church G. bioRxiv 2018. 298620 10.1101/298620