pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
(Plasmid #99690)

• Purpose: Expresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAV
• Depositing Lab: George Church
• Publication: Church Lab CRISPR plasmids 2017 (unpublished)

Backbone

• Vector backbone: pAAV (pUC f1)
  (Search Vector Database)
• Vector type: AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9 and gRNA targeting Actc1
• Species: Synthetic
• Mutation: dead Cas9
• Entrez Gene: Actc1 (a.k.a. Actc-1)
• Tag / Fusion Protein:
  • VPR mini (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: unknown

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

gRNA sequence: GCCATTCTTGGAGCCAAGGG