Skip to main content

AAV-KrasWT/sgKras/Cre
(Plasmid #99848)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99848 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    388-MCS AAV
  • Backbone size w/o insert (bp) 5958
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kras
  • gRNA/shRNA sequence
    GACTGAGTATAAACTTGTGG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2014
  • Mutation
    AvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), Barcode = (AGGCAAGAGCGCCTTGACGATA>AGGCAAGTCGGCACTGACGATA), BsiWI site (CGTGCG>CGTACG)
  • Entrez Gene
    Kras (a.k.a. K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI, AvrII (not destroyed)
  • 3′ cloning site BsiWI, XhoI (not destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-KrasWT/sgKras/Cre was a gift from Monte Winslow (Addgene plasmid # 99848 ; http://n2t.net/addgene:99848 ; RRID:Addgene_99848)
  • For your References section:

    Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity. Winters IP, Chiou SH, Paulk NK, McFarland CD, Lalgudi PV, Ma RK, Lisowski L, Connolly AJ, Petrov DA, Kay MA, Winslow MM. Nat Commun. 2017 Dec 12;8(1):2053. doi: 10.1038/s41467-017-01519-y. 10.1038/s41467-017-01519-y PubMed 29233960