AAV-KrasG13C/sgKras/Cre
(Plasmid
#99856)
-
PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbone388-MCS AAV
- Backbone size w/o insert (bp) 5958
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKras
-
gRNA/shRNA sequenceGACTGAGTATAAACTTGTGG
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2014
-
MutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutations (GACTGAGTATAAACTTGTGGTGG>GACTGAGTATAAACTAGTAGTCG), G13C mutation (GGC>TGC), Barcode = (AGGCAAGAGCGCCTTGACGATA>AGGGAAGTCAGCACTTACAATT), BsiWI site (CGTGCG>CGTACG)
-
Entrez GeneKras (a.k.a. K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI, AvrII (not destroyed)
- 3′ cloning site BsiWI, XhoI (not destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-KrasG13C/sgKras/Cre was a gift from Monte Winslow (Addgene plasmid # 99856 ; http://n2t.net/addgene:99856 ; RRID:Addgene_99856) -
For your References section:
Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity. Winters IP, Chiou SH, Paulk NK, McFarland CD, Lalgudi PV, Ma RK, Lisowski L, Connolly AJ, Petrov DA, Kay MA, Winslow MM. Nat Commun. 2017 Dec 12;8(1):2053. doi: 10.1038/s41467-017-01519-y. 10.1038/s41467-017-01519-y PubMed 29233960