Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics.
Rose JC, Stephany JJ, Valente WJ, Trevillian BM, Dang HV, Bielas JH, Maly DJ, Fowler DM
Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368.
PubMed Article

Plasmids from Article

ID Plasmid Purpose  
100550ciCas9_pcDNA5Expresses ciCas9 in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables.
Loading...
100551ciCas9(L22)_pcDNA5Expresses ciCas9(L22) in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables.
Loading...
100552ciCas9(F22)_pcDNA5Expresses ciCas9(F22) in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables.
Loading...
100553e-ciCas9_pcDNA5Expresses enhanced specificity ciCas9 (e-ciCas9) in mammalian cells. Can be used to generate Flp-In and Flp-In T-REx stables.
Loading...
100554AAVS1_sgRNAExpresses AAVS1 sgRNA. Target sequence: GGGGCCACTAGGGACAGGAT
Loading...
100555EMX1_sgRNAExpresses EMX1 sgRNA. Target sequence: GAGTCCGAGCAGAAGAAGAA
Loading...
100556MYC sgRNA4Expresses MYC sgRNA4. Target sequence: GTAATTCCAGCGAGAGGCAG
Loading...
100557MYC sgRNA5Expresses MYC sgRNA5. Target sequence GAGAGGCAGAGGGAGCGAGC
Loading...
100558EMX1*_sgRNAExpresses EMX1* sgRNA. Target sequence: (G)GAGTCCGAGCAGAAGAAGAA. Same target sequence as #100555, except with an additional 5' G.
Loading...

Antibodies from Article