Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAVS1_sgRNA
(Plasmid #100554)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100554 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    gRNA_cloning_vector (#41824)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AAVS1 sgRNA
  • gRNA/shRNA sequence
    GGGGCCACTAGGGACAGGAT
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1_sgRNA was a gift from Dustin Maly (Addgene plasmid # 100554 ; http://n2t.net/addgene:100554 ; RRID:Addgene_100554)
  • For your References section:

    Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Rose JC, Stephany JJ, Valente WJ, Trevillian BM, Dang HV, Bielas JH, Maly DJ, Fowler DM. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368. 10.1038/nmeth.4368 PubMed 28737741