Skip to main content

Molecular basis of CTCF binding polarity in genome folding.

Nora EP, Caccianini L, Fudenberg G, So K, Kameswaran V, Nagle A, Uebersohn A, Hajj B, Saux AL, Coulon A, Mirny LA, Pollard KS, Dahan M, Bruneau BG
Nat Commun. 2020 Nov 5;11(1):5612. doi: 10.1038/s41467-020-19283-x. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
156429pAU002 - pTRE3G-CTCF(DELTA1-265)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGREVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.
156430pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGREVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.
156431pEN313 - Rad21-Halo-Frt-PGK-EM7-NeoR-bpA-Frt targetingTargeting vector to introduce an Halotag cassette at the mouse Rad21 locus using NEOMYCINE selection. Designed for using with sgRNA CCACGGTTCCATATTATCTG
156432pEN366 - pTRE3G-CTCF-mRuby2-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donorVector to introduce a constitutive rtta3G cassette and a DOX-inducible wild-type CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.
156433pEN487 - Sororin-AID[71-114]-eGFP-FRT-Blast-FRT targeting conuctTargeting vector to introduce an AID-eGFP cassette at the mouse Cdca5 (SORORIN) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA GGGATGCCCGTCATTAAGTG
156434pEN515 - pTRE3G-CTCF(ZFmut)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGREVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA (all Zinc fingers point mutated), targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA.
156435pEN716 - pCAGGS-eGFP-3Xnls-bpAFor transient expression of nuclear eGFP in mammalian cells
156436pEN765 -pCAGGS-3XFLAG-mKate2-(human)PDS5B-bpAFor transient expression of human PDS5B tagged with mKate2
156438pKS004 - pCAGGS-3XFLAG-CTCF-eGFPFor transient expression of mouse CTCF tagged with eGFP
156439pKS016 - pCAGGS-3XFLAG-mKate2-Pds5a-bpAFor transient expression of mouse PDS5A tagged with mKate2
156440pKS021 - pCAGGS-3XFLAG-mKate2-SA1-bpAFor transient expression of mouse SA1 (= STAG1 or SCC3A) tagged with mKate2
156441pKS022 - pCAGGS-3XFLAG-mKate2-SA2-bpAFor transient expression of mouse SA2 (STAG2 or SCC3B) tagged with mKate2
156442pKS023 - pCAGGS-3XFLAG-mKate2-Pds5b-bpAFor transient expression of mouse PDS5B tagged with mKate2
156443pKS031 - pCAGGS-3XFLAG-BORIS-eGFP-bpAFor transient expression of mouse BORIS (CTCFL) tagged with eGFP
156445pKS035 - pCAGGS-3XFLAG-Rad21-mKate2-bpAFor transient expression of mouse RAD21 (SCC1) tagged with mKate2
156447pKS037 - pCAGGS-3XFLAG-Smc3-mKate2-bpAFor transient expression of mouse SMC3 tagged with mKate2
156448pKS070 - pCAGGS-3XFLAG-(human)CTCF-eGFPFor transient expression of human CTCF tagged with eGFP
156449pKS071 - pCAGGS-3XFLAG-mKate2-(human)PDS5A-bpAFor transient expression of human PDS5A tagged with mKate2
156450pX330-EN1082_Rad21_STOPFor transient expression of Cas9 and sgRNA targeting mouse RAD21 stop codon
156451pX330-EN1680_Sororin-CtermFor transient expression of Cas9 and sgRNA targeting mouse Cdc5a (SORORIN) stop codon

Antibodies from Article