Skip to main content

Loss of Integrin-linked kinase sensitizes breast cancer to SRC inhibitors.

Beetham H, Griffith BGC, Murina O, Loftus AE, Parry DA, Temps C, Culley J, Muir M, Unciti-Broceta A, Sims AH, Byron A, Brunton VG
Cancer Res. 2021 Dec 17. pii: 0008-5472.CAN-21-0373. doi: 10.1158/0008-5472.CAN-21-0373. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
163320PX459v2-ILK-gRNA 1-exon 1SpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.
163321PX459v2-ILK-gRNA 2-exon 8SpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.
163322eSpCas9(1.1)-ABL1-gRNA1-exon4eCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.
163323eSpCas9(1.1)-ABL1-gRNA2-exon4eCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.

Antibodies from Article