Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Cd151


Description CD151 antigen
Also known as PETA-3, SFA-1, Tspan24
Species Mus musculus
Entrez ID 12476
MGC ID BC012236

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene, or a homologous gene.

ID Plasmid Gene/Insert PI
54032mEmerald-CD151-7CD151 (Homo sapiens) Davidson
54873mApple-CD151-7CD151 (Homo sapiens) Davidson
55282mTagBFP2-CD151-7CD151 (Homo sapiens) Davidson
55355mCerulean-CD151-7CD151 (Homo sapiens) Davidson
55850mRuby-CD151-7CD151 (Homo sapiens) Davidson
57125mPA-GFP-CD151-7CD151 (Homo sapiens) Davidson
57267Dronpa-CD151-7CD151 (Homo sapiens) Davidson
57358mEos2-CD151-7CD151 (Homo sapiens) Davidson
57595tdEos-CD151-7CD151 (Homo sapiens) Davidson
57707Dendra2-CD151-7CD151 (Homo sapiens) Davidson
58079tdTomato-CD151-7CD151 (Homo sapiens) Davidson
217345gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (Homo sapiens), crFOLH1-1 gRNA: gctccagacctggggtccagttt (Homo sapiens), crCD151-3 gRNA: cgggaggccgcacccaccgcctg (Homo sapiens), crHBG-3 gRNA: ttcttcatccctagccagccgcc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert