Skip to main content
Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
217297 WT-MEK1-V5 MAP2K1 (Homo sapiens) Der Apr 24, 2024
217378 pcDNA3.4-GFP-TEV-B55 B55 (Homo sapiens) Peti Apr 24, 2024
207553 AAVS1 EGFP-Sec61B TET inducible EGFP-Sec61B (Homo sapiens) Schmidt Apr 24, 2024
218192 MBP-Benzonase nucA (Other) Arrowsmith Apr 24, 2024
207580 AAVS1 SNAP-Sec61B TET inducible SNAPTag-Sec61B (Homo sapiens) Schmidt Apr 24, 2024
217832 p4A8_S7T_BC 4A8 variant Fab (Homo sapiens) Whitehead Apr 24, 2024
207549 AAVS1 LAMP1-mNeonGreen HRD TET inducible LAMP1-mNeonGreen (Homo sapiens) Schmidt Apr 24, 2024
207551 AAVS1 EGFP-LC3B HRD TET inducible EGFP-LC3B (Homo sapiens) Schmidt Apr 24, 2024
207552 AAVS1 EGFP-GABARAPL1 HRD TET inducible EGFP-GABARAPL1 (Homo sapiens) Schmidt Apr 24, 2024
216737 pAAV-CMV-SpCas9D10A nickase Cas9-D10A nickase (Other) Dion Apr 24, 2024
216736 pAAV-nEF-SpCas9D10A nickase Cas9-D10A nickase (Other) Dion Apr 24, 2024
216735 pX551-miniCMV-SpCas9D10A nickase Cas9-D10A nickase (Other) Dion Apr 24, 2024
216734 pAAV-U6-sgCTG-CMV-GFP sgCTG (Synthetic) Dion Apr 24, 2024
216733 pLenti-U6-sgCTG-CAG-Cas9D10A nickase-Blast Cas9-D10A nickase and sgCTG (Other) Dion Apr 24, 2024
216732 pLV(gRNA)-CMV-eGFP-U6(sgCTG) sgCTG lentiviral guide RNA with eGFP tag (Synthetic) Dion Apr 24, 2024
207545 SNAP-LC3 HRD SNAPtag with internal PuroR cassette flanked by human LC3B locus sequences (Homo sapiens) Schmidt Apr 24, 2024
207105 SHLD3 KO sgRNA #1 CGCTATCAAGATTTATACCT (Homo sapiens) Schmidt Apr 24, 2024
203222 Halo-ATG9A HRD HaloTag flanked by human ATG9 locus sequences (Homo sapiens) Schmidt Apr 24, 2024
207103 MDC1 KO sgRNA GGTGTAACGTGGAGCCAGTA (Homo sapiens) Schmidt Apr 24, 2024
207607 3xMS2 TR knockin sgRNA 1 cgactcgcccggcagcgcac (Homo sapiens) Schmidt Apr 24, 2024
207610 sgRNA TR KO 2 TCAGGCCGCAGGAAGAGGAA (Homo sapiens) Schmidt Apr 24, 2024
207559 ULK1 sgRNA CCAGCCAGGCCAGAAAGGTC (Homo sapiens) Schmidt Apr 24, 2024
213468 pJET-LB-geneticin Left border of the TSI locus 1-split fragment of geneticin cassette (Other) Hammond-Kosack Apr 24, 2024
198344 Dyn1 R271E E720R Dynamin1 (Homo sapiens) Taraska Apr 24, 2024
198343 Dyn1 R271E Dynamin1 (Homo sapiens) Taraska Apr 24, 2024
198342 Dyn1 R271E D291R Dynamin1 (Homo sapiens) Taraska Apr 24, 2024
198341 Dyn1 D406A Dynamin1 (Homo sapiens) Taraska Apr 24, 2024
198340 Dyn1 K44A Dynamin1 (Homo sapiens) Taraska Apr 24, 2024
208913 OTR untagged OXTR (Homo sapiens) Gruber Apr 24, 2024
208902 Lneg-INTR-GFP INTR (Other) Gruber Apr 24, 2024
181721 pAG416-GAL-TDP-43-M337V TDP-43 (Homo sapiens) Chavez Apr 24, 2024
181720 pAG416-GAL-TDP-43-N267S TDP-43 (Homo sapiens) Chavez Apr 24, 2024
181719 pAG416-GAL-TDP-43-Q331K TDP-43 (Homo sapiens) Chavez Apr 24, 2024
181718 pAG416-GAL-FUS-R521C FUS (Homo sapiens) Chavez Apr 24, 2024
181717 pAG416-GAL-FUS-P431L FUS (Homo sapiens) Chavez Apr 24, 2024
181716 pAG416-GAL-FUS-G156E FUS (Homo sapiens) Chavez Apr 24, 2024
181711 pAG416-GAL-FUS FUS (Homo sapiens) Chavez Apr 24, 2024
181710 pAG416-GAL-hnRNPA1 hnRNPA1 (Homo sapiens) Chavez Apr 24, 2024
181709 pAG416-GAL-TDP-43 TDP-43 (Homo sapiens) Chavez Apr 24, 2024
181707 pAG426-GAL-Kar2-Beta-Amyloid Kar2-Beta-Amyloid (Homo sapiens) Chavez Apr 24, 2024
217361 pIDTSmart-MbPylRS M. barkeri pyrrolysyl-tRNA synthetase (Other) Chatterjee Apr 24, 2024
181706 pAG416-GAL-RNQ1 RNQ1 (Saccharomyces cerevisiae) Chavez Apr 24, 2024
216416 pDisplay-oROS-HT pDisplay-oROS-HT (Other) Berndt Apr 24, 2024
216415 AAV2_CAG_oROS-HT(C199S)_WPRE oROS-HT(C199S) (Other) Berndt Apr 24, 2024
216414 AAV2_CAG_oROS-HT_WPRE oROS-HT (Other) Berndt Apr 24, 2024
216116 AAV2_CAG_oROS-G_LF(C199S) oROS-G_LF(C199S) Berndt Apr 24, 2024
216115 AAV2_CAG_oROS-G oROS-G (Other) Berndt Apr 24, 2024
216114 pC3.1_CAG_oROS-Gr_LF(C199S) oROS-Gr_LF(C199S) (Other) Berndt Apr 24, 2024
216113 pC3.1_CAG_oROS-Gr CAG_oROS-Gr (Other) Berndt Apr 24, 2024
209701 pAAV-Dlx-FLEX-hM4Di-mCherry hM4D(Gi) Wulff Apr 24, 2024