Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
206614 Anti-HCN3 [N141/21R] anti-HCN3 (Mus musculus) recombinant Mouse monoclonal antibody (Mus musculus) Trimmer May 06, 2024
216211 SGLT2(GFP)-MAP17(nb) SGLT2 GFP fusion and MAP17 nanobody fusion (Homo sapiens) Chen May 06, 2024
207097 ATM C-terminal sgRNA TTTCTAAAGGCTGAATGAAA (Homo sapiens) Schmidt May 06, 2024
218582 peGFP C2-IST1 IST1 (Homo sapiens) Meyer May 06, 2024
218581 peGFP C3-SPG20-PAAA SPG20 (Homo sapiens) Meyer May 06, 2024
218580 peGFP C1-SPG20 SC domain SPG20 (Homo sapiens) Meyer May 06, 2024
217817 mouse b8 full length ITGB8 (Mus musculus) Springer May 06, 2024
218579 peGFP C3-SPG20 8xV SPG20 (Homo sapiens) Meyer May 06, 2024
218578 peGFP C3-SPG20 SPG20 (Homo sapiens) Meyer May 06, 2024
217818 human a5 full length ITGA5 (Homo sapiens) Springer May 06, 2024
214812 pCMV-PE7 PE7 (Synthetic) Adamson May 06, 2024
213009 pLenti_ABE8e-SpRY-P2A-BFP_HygroR ABE8e-SpRY-D10A (Synthetic) Sherwood May 06, 2024
213008 lentiCRISPRv2FE-ABE8e-SpRY ABE8e-SpRY-D10A (Synthetic) Sherwood May 06, 2024
155380 pJK503 dCas12a (F. novicida) (Other), PA4-mVenus, dCas12a oscillator crRNAs (Synthetic) Silver May 04, 2024
213142 pAAV-pTH-iCre:EGFP-WPREpA iCre (Other) Gether May 03, 2024
199654 pR6K-crRNA-CASTIF CAST I-F systems (Synthetic) Finkelstein May 03, 2024
199653 pR6K-GFP-CASTIF CAST I-F systems (Synthetic) Finkelstein May 03, 2024
218654 msFam160b1 (msFHIP2A) g1 lentiCRISPRv2-mCherry Fam160b1 (Mus musculus) Harper May 03, 2024
218644 pDONR221 hNLRP3-mNG-STOP NLRP3 (Homo sapiens) Harper May 03, 2024
218640 pDONR221 msNLRP3(ΔPYD, I125M-END) (STOP) NLRP3 (Mus musculus) Harper May 03, 2024
218647 pDONR221 hNLRP3 R262W (disease-associated mutation) NLRP3 (Homo sapiens) Harper May 03, 2024
199659 pTniQ-Cascade TniQ cas8 cas7 cas6 (Other) Finkelstein May 03, 2024
199657 pR6K-GFP-CASTV CAST V systems (Other) Finkelstein May 03, 2024
199656 pR6K-crRNA-CASTIB CAST I-B systems (Other) Finkelstein May 03, 2024
199655 pR6K-GFP-CASTIB CAST I-B systems (Other) Finkelstein May 03, 2024
199652 pR6K-GFP-RFP Finkelstein May 03, 2024
185546 CMV-IgK-pHluorin-TM-mRuby IgK-pHluorin-TM-mRuby (Rattus norvegicus) de Juan-Sanz May 03, 2024
185545 CamKII-LGI1-C200R-pHluorin LGI1 (Rattus norvegicus) de Juan-Sanz May 03, 2024
185544 CamKII-LGI1-E383A-pHluorin LGI1 (Rattus norvegicus) de Juan-Sanz May 03, 2024
185543 CamKII-LGI1-T380A-pHluorin LGI1 (Rattus norvegicus) de Juan-Sanz May 03, 2024
185542 CamKII-LGI1-R474Q-pHluorin LGI1 (Rattus norvegicus) de Juan-Sanz May 03, 2024
185541 CamKII-LGI1-Y433A-pHluorin LGI1 (Rattus norvegicus) de Juan-Sanz May 03, 2024
185540 CamKII-LGI1-S473L-pHluorin LGI1 (Rattus norvegicus) de Juan-Sanz May 03, 2024
185539 CamKII-ADAM23-pHluorin ADAM23 (Rattus norvegicus) de Juan-Sanz May 03, 2024
185538 CamKII-LGI1-pHmScarlet LGI1 (Rattus norvegicus) de Juan-Sanz May 03, 2024
185537 CamKII-LGI1-pHluorin LGI1 (Rattus norvegicus) de Juan-Sanz May 03, 2024
207081 Rif1-Halo HRD HaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences (Homo sapiens) Schmidt May 03, 2024
207080 RNF168-Halo HRD HaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences (Homo sapiens) Schmidt May 03, 2024
207109 Halo-MDC1 PST deletion HaloTag-MDC1 PST deletion (Homo sapiens) Schmidt May 03, 2024
207110 Halo-MDC1 BRCT domain deletion HaloTag-MDC1 BRCT domain deletion (Homo sapiens) Schmidt May 03, 2024
207083 RNF169-Halo HRD HaloTag followed by BGH PolyA and PuroR cassette flanked by human RNF169 locus sequences (Homo sapiens) Schmidt May 03, 2024
218372 pWH1266-Apra-sgRNA sgRNA expression cassette (Synthetic) Gebhardt May 02, 2024
218368 pUC18T-mini-Tn7T-hph-Ptet2 Gebhardt May 02, 2024
218367 pUC18T-mini-Tn7T-hph-Ptet1 Gebhardt May 02, 2024
218364 pUC18T-mini-Tn7T-hph-Ptac Gebhardt May 02, 2024
218369 pUC18T-mini-Tn7T-hph-Ptol Gebhardt May 02, 2024
218370 pUC18T-mini-Tn7T-hph-lacZ Gebhardt May 02, 2024
218357 pMApra-Ptac Gebhardt May 02, 2024
218218 pK3-g3g4-K4 AtU6 promoters and sgRNA scaffolds (Arabidopsis thaliana) Voytas May 02, 2024
218219 pK5-g5g6-K6 AtU6 promoters and sgRNA scaffolds (Arabidopsis thaliana) Voytas May 02, 2024