|
|
206614 |
Anti-HCN3 [N141/21R] |
anti-HCN3 (Mus musculus) recombinant Mouse monoclonal antibody (Mus musculus)
|
Trimmer |
May 06, 2024 |
|
|
216211 |
SGLT2(GFP)-MAP17(nb) |
SGLT2 GFP fusion and MAP17 nanobody fusion (Homo sapiens)
|
Chen |
May 06, 2024 |
|
|
207097 |
ATM C-terminal sgRNA |
TTTCTAAAGGCTGAATGAAA (Homo sapiens)
|
Schmidt |
May 06, 2024 |
|
|
218582 |
peGFP C2-IST1 |
IST1 (Homo sapiens)
|
Meyer |
May 06, 2024 |
|
|
218581 |
peGFP C3-SPG20-PAAA |
SPG20 (Homo sapiens)
|
Meyer |
May 06, 2024 |
|
|
218580 |
peGFP C1-SPG20 SC domain |
SPG20 (Homo sapiens)
|
Meyer |
May 06, 2024 |
|
|
217817 |
mouse b8 full length |
ITGB8 (Mus musculus)
|
Springer |
May 06, 2024 |
|
|
218579 |
peGFP C3-SPG20 8xV |
SPG20 (Homo sapiens)
|
Meyer |
May 06, 2024 |
|
|
218578 |
peGFP C3-SPG20 |
SPG20 (Homo sapiens)
|
Meyer |
May 06, 2024 |
|
|
217818 |
human a5 full length |
ITGA5 (Homo sapiens)
|
Springer |
May 06, 2024 |
|
|
214812 |
pCMV-PE7 |
PE7 (Synthetic)
|
Adamson |
May 06, 2024 |
|
|
213009 |
pLenti_ABE8e-SpRY-P2A-BFP_HygroR |
ABE8e-SpRY-D10A (Synthetic)
|
Sherwood |
May 06, 2024 |
|
|
213008 |
lentiCRISPRv2FE-ABE8e-SpRY |
ABE8e-SpRY-D10A (Synthetic)
|
Sherwood |
May 06, 2024 |
|
|
155380 |
pJK503 |
dCas12a (F. novicida) (Other), PA4-mVenus, dCas12a oscillator crRNAs (Synthetic)
|
Silver |
May 04, 2024 |
|
|
213142 |
pAAV-pTH-iCre:EGFP-WPREpA |
iCre (Other)
|
Gether |
May 03, 2024 |
|
|
199654 |
pR6K-crRNA-CASTIF |
CAST I-F systems (Synthetic)
|
Finkelstein |
May 03, 2024 |
|
|
199653 |
pR6K-GFP-CASTIF |
CAST I-F systems (Synthetic)
|
Finkelstein |
May 03, 2024 |
|
|
218654 |
msFam160b1 (msFHIP2A) g1 lentiCRISPRv2-mCherry |
Fam160b1 (Mus musculus)
|
Harper |
May 03, 2024 |
|
|
218644 |
pDONR221 hNLRP3-mNG-STOP |
NLRP3 (Homo sapiens)
|
Harper |
May 03, 2024 |
|
|
218640 |
pDONR221 msNLRP3(ΔPYD, I125M-END) (STOP) |
NLRP3 (Mus musculus)
|
Harper |
May 03, 2024 |
|
|
218647 |
pDONR221 hNLRP3 R262W (disease-associated mutation) |
NLRP3 (Homo sapiens)
|
Harper |
May 03, 2024 |
|
|
199659 |
pTniQ-Cascade |
TniQ cas8 cas7 cas6 (Other)
|
Finkelstein |
May 03, 2024 |
|
|
199657 |
pR6K-GFP-CASTV |
CAST V systems (Other)
|
Finkelstein |
May 03, 2024 |
|
|
199656 |
pR6K-crRNA-CASTIB |
CAST I-B systems (Other)
|
Finkelstein |
May 03, 2024 |
|
|
199655 |
pR6K-GFP-CASTIB |
CAST I-B systems (Other)
|
Finkelstein |
May 03, 2024 |
|
|
199652 |
pR6K-GFP-RFP |
|
Finkelstein |
May 03, 2024 |
|
|
185546 |
CMV-IgK-pHluorin-TM-mRuby |
IgK-pHluorin-TM-mRuby (Rattus norvegicus)
|
de Juan-Sanz |
May 03, 2024 |
|
|
185545 |
CamKII-LGI1-C200R-pHluorin |
LGI1 (Rattus norvegicus)
|
de Juan-Sanz |
May 03, 2024 |
|
|
185544 |
CamKII-LGI1-E383A-pHluorin |
LGI1 (Rattus norvegicus)
|
de Juan-Sanz |
May 03, 2024 |
|
|
185543 |
CamKII-LGI1-T380A-pHluorin |
LGI1 (Rattus norvegicus)
|
de Juan-Sanz |
May 03, 2024 |
|
|
185542 |
CamKII-LGI1-R474Q-pHluorin |
LGI1 (Rattus norvegicus)
|
de Juan-Sanz |
May 03, 2024 |
|
|
185541 |
CamKII-LGI1-Y433A-pHluorin |
LGI1 (Rattus norvegicus)
|
de Juan-Sanz |
May 03, 2024 |
|
|
185540 |
CamKII-LGI1-S473L-pHluorin |
LGI1 (Rattus norvegicus)
|
de Juan-Sanz |
May 03, 2024 |
|
|
185539 |
CamKII-ADAM23-pHluorin |
ADAM23 (Rattus norvegicus)
|
de Juan-Sanz |
May 03, 2024 |
|
|
185538 |
CamKII-LGI1-pHmScarlet |
LGI1 (Rattus norvegicus)
|
de Juan-Sanz |
May 03, 2024 |
|
|
185537 |
CamKII-LGI1-pHluorin |
LGI1 (Rattus norvegicus)
|
de Juan-Sanz |
May 03, 2024 |
|
|
207081 |
Rif1-Halo HRD |
HaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences (Homo sapiens)
|
Schmidt |
May 03, 2024 |
|
|
207080 |
RNF168-Halo HRD |
HaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences (Homo sapiens)
|
Schmidt |
May 03, 2024 |
|
|
207109 |
Halo-MDC1 PST deletion |
HaloTag-MDC1 PST deletion (Homo sapiens)
|
Schmidt |
May 03, 2024 |
|
|
207110 |
Halo-MDC1 BRCT domain deletion |
HaloTag-MDC1 BRCT domain deletion (Homo sapiens)
|
Schmidt |
May 03, 2024 |
|
|
207083 |
RNF169-Halo HRD |
HaloTag followed by BGH PolyA and PuroR cassette flanked by human RNF169 locus sequences (Homo sapiens)
|
Schmidt |
May 03, 2024 |
|
|
218372 |
pWH1266-Apra-sgRNA |
sgRNA expression cassette (Synthetic)
|
Gebhardt |
May 02, 2024 |
|
|
218368 |
pUC18T-mini-Tn7T-hph-Ptet2 |
|
Gebhardt |
May 02, 2024 |
|
|
218367 |
pUC18T-mini-Tn7T-hph-Ptet1 |
|
Gebhardt |
May 02, 2024 |
|
|
218364 |
pUC18T-mini-Tn7T-hph-Ptac |
|
Gebhardt |
May 02, 2024 |
|
|
218369 |
pUC18T-mini-Tn7T-hph-Ptol |
|
Gebhardt |
May 02, 2024 |
|
|
218370 |
pUC18T-mini-Tn7T-hph-lacZ |
|
Gebhardt |
May 02, 2024 |
|
|
218357 |
pMApra-Ptac |
|
Gebhardt |
May 02, 2024 |
|
|
218218 |
pK3-g3g4-K4 |
AtU6 promoters and sgRNA scaffolds (Arabidopsis thaliana)
|
Voytas |
May 02, 2024 |
|
|
218219 |
pK5-g5g6-K6 |
AtU6 promoters and sgRNA scaffolds (Arabidopsis thaliana)
|
Voytas |
May 02, 2024 |