|
|
193070 |
pFUW-tetO-mCh-Gata2-del-NLS(380-440) |
mCh-Gata2-del-NSL(380-440) (Mus musculus)
|
Pereira |
Aug 07, 2023 |
|
|
193069 |
pFUW-tetO-mCh-Gata2-del-C-ZF(343-379) |
mCh-Gata2-del-C-ZF(343-379) (Mus musculus)
|
Pereira |
Aug 07, 2023 |
|
|
193068 |
pFUW-tetO-mCh-Gata2-del-N-ZF(287-342) |
mCh-Gata2-del-N-ZF(287-342) (Mus musculus)
|
Pereira |
Aug 07, 2023 |
|
|
193067 |
pFUW-tetO-mCh-Gata2-del-N-Terminal(1-235) |
mCh-Gata2-del-N-Terminal(1-235) (Mus musculus)
|
Pereira |
Aug 07, 2023 |
|
|
193066 |
pHAGE-cFos-mCh |
cfos-mCh (Mus musculus)
|
Pereira |
Aug 07, 2023 |
|
|
193065 |
pHAGE-Gfi1b-mCh |
Gfi1b-mCh (Mus musculus)
|
Pereira |
Aug 07, 2023 |
|
|
193064 |
pHAGE-Gata2-mCh |
Gata2-mCh (Mus musculus)
|
Pereira |
Aug 07, 2023 |
|
|
193063 |
pFUW-teto-mch-cFos |
mch-cFos (Mus musculus)
|
Pereira |
Aug 07, 2023 |
|
|
193062 |
pFUW-tetO-mCh-Gfi1b |
mCh-Gfi1b (Mus musculus)
|
Pereira |
Aug 07, 2023 |
|
|
193061 |
pFUW-tetO-mCh-Gata2 |
mCh-Gata2 (Mus musculus)
|
Pereira |
Aug 07, 2023 |
|
|
193060 |
pFUW-tetO-mCherry |
mCherry
|
Pereira |
Aug 07, 2023 |
|
|
197854 |
pJMC-5-Empty |
|
Voytas |
Aug 07, 2023 |
|
|
204722 |
iE61 PB-Zim3-XTEN-dCas9-mScarlet-puro-BFP |
Zim3-dCas9 (Synthetic)
|
Ward |
Aug 07, 2023 |
|
|
191655 |
pCRISPomyces-AsCas12j-2 |
AsCas12j-2 (Other)
|
Wong |
Aug 07, 2023 |
|
|
204725 |
iF51 PB-Zim3-dCas9-mScarlet-Hygro-Neo-SnapTag |
Zim3-dCas9 (Synthetic)
|
Ward |
Aug 07, 2023 |
|
|
201131 |
plex_307-EYFP-ccdB-blasticidin |
|
Chavez |
Aug 07, 2023 |
|
|
201129 |
plex_307-EYFP-ccdB-zeo |
|
Chavez |
Aug 07, 2023 |
|
|
201128 |
plex_307-EYFP-ccdB-g418 |
|
Chavez |
Aug 07, 2023 |
|
|
161664 |
IDG_CLCN6_OE_1 |
CLCN6 (Homo sapiens)
|
McManus |
Aug 05, 2023 |
|
|
195570 |
pTet-Bxb1-Xis-mScarlet |
Bxb1 Excisionase Fused With mScarlet (Synthetic)
|
Murray |
Aug 04, 2023 |
|
|
202070 |
pGEX-2T_E30_VP1 |
E30 VP1 protein with Histag (Synthetic)
|
Hytönen |
Aug 04, 2023 |
|
|
204720 |
iD20 LoxStopLox-Zim3-dCas9-mApple-hygro |
Zim3-dCas9 (Synthetic)
|
Ward |
Aug 04, 2023 |
|
|
201917 |
pJRH-1346 U6-B2M sgRNA Gag-pol v2 |
Gag-pol, B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
|
Doudna |
Aug 04, 2023 |
|
|
201913 |
pJRH-1187 VSVGmut |
VSV-G (K47Q, R354A) (Other)
|
Doudna |
Aug 04, 2023 |
|
|
201914 |
pJRH-1179 U6-reci Gag-Cas9 v2 |
Gag-Cas9 v2
|
Doudna |
Aug 04, 2023 |
|
|
204719 |
iC10 PB-zim3-mycNLS-mApple-hygro |
Zim3-dCas9 (Synthetic)
|
Ward |
Aug 04, 2023 |
|
|
201915 |
pJRH-1180 U6-reci Gag-pol v2 |
Gag-pol
|
Doudna |
Aug 04, 2023 |
|
|
201912 |
pJRH-1362 scFv entry plasmid |
Stuffer sequence (drop out for scFv cloning) + CD8 hinge and transmembrane domain
|
Doudna |
Aug 04, 2023 |
|
|
204718 |
iB22 PB-zim3-mycNLS-mApple |
Zim3-dCas9 (Synthetic)
|
Ward |
Aug 04, 2023 |
|
|
201916 |
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2 |
Gag-Cas9 v2, B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
|
Doudna |
Aug 04, 2023 |
|
|
198948 |
pGL0_35 [aadA] |
aadA (Other)
|
Ostrov |
Aug 04, 2023 |
|
|
198975 |
pGL0_64 [mScarlet] |
mScarlet-I (Synthetic)
|
Ostrov |
Aug 04, 2023 |
|
|
202069 |
pGEX-2T_CVB1_VP1 |
CVB1 VP1 protein with Histag (Synthetic)
|
Hytönen |
Aug 04, 2023 |
|
|
202068 |
pGEX-2T_CVA4_VP1 |
CVA4 VP1 protein with Histag (Synthetic)
|
Hytönen |
Aug 04, 2023 |
|
|
199120 |
pDT4 |
synthetic transcription template
|
Gelles |
Aug 04, 2023 |
|
|
199119 |
pDT2 |
lambda PR' - repeat cassette - E. coli rpoB - lambda TR' (Synthetic)
|
Gelles |
Aug 04, 2023 |
|
|
199118 |
pKI1 |
H6-SNAP-RapA (Other)
|
Gelles |
Aug 04, 2023 |
|
|
195580 |
pAAV_hSynapsin1_NOPLight1 |
NOPLight1 (Homo sapiens)
|
Patriarchi |
Aug 04, 2023 |
|
|
195579 |
pCMV_NOPLight-ctr |
NOPLight-ctr (Homo sapiens)
|
Patriarchi |
Aug 04, 2023 |
|
|
195578 |
pCMV_NOPlight1 |
NOPLight1 (Homo sapiens)
|
Patriarchi |
Aug 04, 2023 |
|
|
199149 |
RB821 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199148 |
RB820 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199147 |
RB819 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199145 |
RB817 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199144 |
RB816 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199143 |
RB815 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199142 |
RB814 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199141 |
RB813 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199140 |
RB812 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |
|
|
199139 |
RB811 |
100 bp barcoding cassette (Synthetic)
|
Bennett |
Aug 04, 2023 |