Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
195534 pAAV-CAG-DIO-pAceR-Kv2.1PR pAceR-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 31, 2023
195529 pAAV-CaMKII-pAce-Kv2.1PR pAce-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 31, 2023
195530 pAAV-CaMKII-VARNAM2-Kv2.1PR VARNAM2-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 31, 2023
195535 pAAV-CAG-fDIO-pAce-Kv2.1PR pAce-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 31, 2023
195536 pAAV-CAG-fDIO-VARNAM2-Kv2.1PR VARNAM2-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 31, 2023
195531 pAAV-CaMKII-pAceR-Kv2.1PR pAceR-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 31, 2023
193395 pNC-Green0029-35S Yan Jan 31, 2023
192105 pLenti4/V5-DEST-LASSIE LASSIE (Homo sapiens) Boon Jan 31, 2023
195343 GFP-itis pBE-nt ecTadA(8e)-SpCas9-NG (Synthetic), gRNA gtgcacgacgccgtatgcga Komor Jan 31, 2023
195342 GFP-itis pBE-t ecTadA(8e)-SpCas9-NG (Synthetic), gRNA ctctacgcgggtcttgtagt Komor Jan 31, 2023
183800 pAAV-CMV-eBFP2-NLS-pA eBFP2-NLS (Other) Ploski Jan 31, 2023
195532 pAAV-CAG-DIO-Ace-mNeon2-Kv2.1PR Ace-mNeon2-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 31, 2023
194013 pIS002 C16 Ex3 XTR f1 (Mus musculus) Whitehead Jan 31, 2023
194014 pIS003 C16 Ex4 XTR f1 (Mus musculus) Whitehead Jan 31, 2023
188320 pLGR002 LGR Cas9 guide vector Przybyla Jan 31, 2023
195523 pAAV-Syn-pAce-Kv2.1PR pAce-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 31, 2023
195522 pAAV-Syn-Ace-mNeon2-Kv2.1PR Ace-mNeon2-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 31, 2023
195527 pAAV-CaMKII-VARNAM2 VARNAM2 (Synthetic) Pieribone Jan 31, 2023
195518 pAAV-Syn-Ace-mNeon2 Ace-mNeon2 (Synthetic) Pieribone Jan 31, 2023
196064 YW347_Ptbb2UTR-loxP-RFP-miniMOS myo2p driven tagRFP (Caenorhabditis elegans), NeoR (Caenorhabditis elegans), Minimal Mos1 (Drosophila melanogaster) Yang Jan 31, 2023
196063 YW249_Pzipt17-loxP-H2BGFP-miniMOS H2B::GFP (Caenorhabditis elegans), NeoR (Caenorhabditis elegans), Minimal Mos1 (Drosophila melanogaster), zipt17p::zipt17::zipt17 3UTR (Caenorhabditis elegans) Yang Jan 31, 2023
192643 pCK760 BBa_J23110-sfGFP (Synthetic) Zalatan Jan 31, 2023
194079 piggyBAC-H2B FR-MQV FR-MQV (Synthetic) Jimenez Jan 30, 2023
175770 pHAGE-eGFP-TAX1BP1 Q770A E774K TAX1BP1 (Homo sapiens) Harper Jan 30, 2023
195526 pAAV-CaMKII-Ace-mNeon2 Ace-mNeon2 (Synthetic) Pieribone Jan 30, 2023
191815-rAb Anti-Lgi1 [N283/7R] (Recombinant Antibody) Trimmer Jan 30, 2023
191810-rAb.T Anti-mGluR1/5 [N75/3R] (Recombinant Antibody trial size) Trimmer Jan 30, 2023
191810-rAb Anti-mGluR1/5 [N75/3R] (Recombinant Antibody) Trimmer Jan 30, 2023
184205-rAb.T Anti-TrpC5 [N67/15R] (Recombinant Antibody trial size) Trimmer Jan 30, 2023
184205-rAb Anti-TrpC5 [N67/15R] (Recombinant Antibody) Trimmer Jan 30, 2023
192037-rAb.T Anti-Fig4/Sac3 [N202/7R] (Recombinant Antibody trial size) Trimmer Jan 30, 2023
192037-rAb Anti-Fig4/Sac3 [N202/7R] (Recombinant Antibody) Trimmer Jan 30, 2023
191820-rAb.T Anti-LAR/PTPRF [N165/38R] (Recombinant Antibody trial size) Trimmer Jan 30, 2023
191820-rAb Anti-LAR/PTPRF [N165/38R] (Recombinant Antibody) Trimmer Jan 30, 2023
191815-rAb.T Anti-Lgi1 [N283/7R] (Recombinant Antibody trial size) Trimmer Jan 30, 2023
193445-rAb Anti-GFAP [N206A/8R] (Recombinant Antibody) Trimmer Jan 30, 2023
193442-rAb.T Anti-Calbindin [L109/57R] (Recombinant Antibody trial size) Trimmer Jan 30, 2023
193442-rAb Anti-Calbindin [L109/57R] (Recombinant Antibody) Trimmer Jan 30, 2023
193445-rAb.T Anti-GFAP [N206A/8R] (Recombinant Antibody trial size) Trimmer Jan 30, 2023
195520 pAAV-Syn-VARNAM2 VARNAM2 (Synthetic) Pieribone Jan 30, 2023
195524 pAAV-Syn-VARNAM2-Kv2.1PR VARNAM2-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 30, 2023
195521 pAAV-Syn-pAceR pAceR (Synthetic) Pieribone Jan 30, 2023
195525 pAAV-Syn-pAceR-Kv2.1PR pAceR-Kv2.1 proximal restriction sequence (Synthetic) Pieribone Jan 30, 2023
195001 pPEPT1 Hyvönen Jan 30, 2023
195002 pExp-RBD-CHis RBD (Other) Hyvönen Jan 30, 2023
195865 pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA high fidelity (hf) version of CasRx (hfCas13d) (Other) Ploski Jan 30, 2023
195867 pAAV-2X(CMV-eBFP2-3XNLS-pA) eBFP2 (Other) Ploski Jan 30, 2023
194328 pSBtet rtTA G72V SE Δsplice GP Luc Luciferase (Synthetic) McLellan Jan 30, 2023
195864 pAAV-CMV-intron-hfCas13d-pA high fidelity (hf) version of CasRx (hfCas13d) (Other) Ploski Jan 30, 2023
195866 pAAV-CMV-intron-DIO-hfCas13d-pA high fidelity (hf) version of CasRx (hfCas13d) (Other) Ploski Jan 30, 2023