Sequence Analyzer: pMS84 (U6p::GGACAGTCCTGCCGAGGTGG) Sequencing Result
The new visualizations may take a few seconds to load. Thank you for your patience as we work to enhance our plasmid and sequence displays.
Status:
Sequence View
Restriction Enzymes
Instructions: By default, all cutters are shown. Filter on number of cut sites or search by enzyme name.
Filter
| Enzyme | Cut Site (bp) | Total Cuts |
|---|
Features
| Feature | Location (bp) | Size | Color | Direction | Type |
|---|
Primers
| Primer Name | Sequence (5' to 3') | Binding Sites (bp) | Length (bases) | Direction |
|---|
BLAST
BLAST (Basic Local Alignment Search Tool) finds regions of similarity between biological sequences. Click on the buttons below to submit a BLAST search to NCBI. The results will appear in a new window. See your recent BLAST results on NCBI's website.
-
Nucleotide-Nucleotide BLAST (BLASTN)
-
Translated Nucleotide-Protein BLAST (BLASTX)
-
Sequence alignment using BLAST (BLAST2)
Sequence Analyzer Guide
- Map
Displays a graphical map based on nucleotide sequence data labeled with restriction enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. Hovering over data labels will display additional information (e.g. cut site)
- Sequence
Displays both strands of base paired nucleotide sequences with annotated enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. Hovering over data labels will display additional information (e.g. cut site).
- Enzymes
List of restriction enzymes that can cut a given nucleotide sequence. Table lists enzyme name and the sequence location of the cut.
- Features
List of common features detected in a given nucleotide sequence. Table lists feature name, location, size, color used to indicate its position on the map, and direction (if relevant).
- Primers
List of commonly used primers detected in a given nucleotide sequence. Table lists primer name, sequence, length, binding site location, and direction.
- BLAST
Use Basic Local Alignment Search Tool (BLAST) via the NCBI website to determine similarity between a given sequence and nucleotide (BLASTN) or protein (BLASTX) sequence databases. Additionally, align a custom nucleotide sequence against a given sequence using BLAST2.