We narrowed to 162,449 results for: addgene
-
Plasmid#67789PurposeUse together with pCMV-intron and VSV-G to package MMLV reporter virusDepositorInsertMMLV-LTR-GFP
UseTagsExpressionMutationPromoterAvailable sinceSept. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-mRFP1-Human UTROPHIN_1-261
Plasmid#225052PurposeExpress in mammalian cells the mRFP1 fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and RFP1 (UTRN Human, Homo Sapiens)
UseLentiviralTagsHuman UTROPHIN 1-261 and mRFP1ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26739-R…PromoterCMV promoter and enhancerAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EGFP-Human-UTROPHIN_1-261
Plasmid#222393PurposeExpress in mammalian cells the EGFP fused to residues 1-261 of Human Utrophin to detect filamentous actin in live, fix cels or tissues.DepositorInsertHuman Utrophin residues 1-261 and EGFP (UTRN Human, Homo Sapiens)
UseLentiviralTagsEGFP and Human UTROPHIN 1-261ExpressionMammalianMutationSequence is derived from ADDGENE Plasmid #26737-G…PromoterCMV promoter and enhancerAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CarO-BFP2-TSERex
Plasmid#124795PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertCarO-BFP2
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Mac-BFP2-TSERex
Plasmid#124793PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertMac-BFP2
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHACK-GAL4>QF2(newHA1)
Plasmid#104873PurposeHACK Donor plasmids for converting GAL4 lines to QF2 lines using HACK method. Updated version of Addgene#80275 for easier cloning of insertsDepositorInsertT2A-QF2
UseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceMarch 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
MCP-EGFP-PiggyBac
Plasmid#190003PurposeExpression of MCP-EGFP in mammalian cells. To clone this plasmid, Addgene plasmid #119908 was used. We replaced the tandem coat proteins and double tagRFP with a single coat protein fused to EGFP.DepositorInsertMCP-EGFP
UseTagsExpressionMutationPromoterAvailable sinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-NED
Plasmid#109358PurposeMammalian vector for expressing effector domains fused to dCas9.DepositorTypeEmpty backboneUseCRISPRTagsdCas9, SV40 NLS, 3xFLAGExpressionMammalianMutationPromoterCMVAvailable sinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-CXCR4 (neo)
Plasmid#192077PurposeLentivirus for expression of CXCR4DepositorInsertCXCR4 (CXCR4 Human)
UseLentiviralTagsExpressionMutationPromoterhPGKAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
ERoxBFP
Plasmid#68126Purposemammalian expression of ER localized oxBFPDepositorInsertoxBFP
UseTagsKDEL ER retention sequence and bovine prolactin s…ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pL1P4 ZmUbiP:GRF-GIF:NosT
Plasmid#198048PurposeMoClo Golden Gate Level 1 Position 4. Overexpression cassette of Growth-Regulating Factor 4 (GRF4) plus GRF-Interacting Factor 1 (GRF4-GIF1). Improves in vitro wheat regeneration and transformation.InsertZmUbiP::TaGRF4-GIF1::NosT
UseSynthetic BiologyTagsExpressionMutationPromoterZea mays (maize) ubiquitin promoterAvailable sinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
ULK1 sgRNA
Plasmid#207559PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCAGCCAGGCCAGAAAGGTC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
TALEN-mROSA26 ELD
Plasmid#60026PurposeExpression of a TALEN protein specific for mouse ROSA26 locus.DepositorInsertTALEN-ROSA26
UseTALENTagsExpressionMammalianMutationPromoterAvailable sinceNov. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
7TG
Plasmid#24314DepositorInsert7xTcf-eGFP
UseLentiviralTagsExpressionMutationEGFP is GFP with S65T and F64L mutationsPromoterAvailable sinceApril 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF-I-GFP GX
Plasmid#45443DepositorTypeEmpty backboneUseTagsIRES EGFPExpressionMammalianMutationPromoterhuman EF1αAvailable sinceJuly 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-AAVS1_hspCas9
Plasmid#193309PurposeCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 AAVS1 sgRNA (V2.0)
UseCRISPRTagsExpressionMammalianMutationnot applicablePromoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only