We narrowed to 17,288 results for: REV
-
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pAIP4_3ONH
Plasmid#234179PurposeHeterologous protein expression of ubiquitin-activating enzyme E1-like in Escherichia coliDepositorAvailable SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHACK-Sparse.FRT10-GAL4.DBD
Plasmid#232833PurposeSparse.FRT10 GAL4.DBD for HACK systemDepositorAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBP-Sparse.FRT10-GAL4.DBD
Plasmid#232831PurposeEnhancer-free Sparse.FRT10 GAL4.DBD with ccdB for GatewayDepositorInsertsExpressionInsectAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 F108A+
Plasmid#231875PurposeBacterial expression of N-terminally 6His tagged Gcn4 F108A+DepositorInsertGcn4 F108A+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationF108A, T121L, A141PPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only