We narrowed to 11,884 results for: CHL
-
Plasmid#172727PurposeEncodes Part 1a of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11-G312G
Plasmid#154026PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 11 c.936T>G, p.G312G (Synonymous Mutation)DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.936T>G, p.G312GAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINK-EFS-HA-5'-CACNA1C
Plasmid#244296Purpose5' AAVLINK plasmid for CACNA1C expressionDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINKv1-pCALM1-Cre-3'-CACNA1C-FLAG
Plasmid#244297Purpose3' AAVLINK plasmid for CACNA1C expressionDepositorAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CCLMPC_CAT
Plasmid#237500PurposeDual promoter lentiviral expression control vectorDepositorInsertChloramphenicol acetyl transferase fusion protein
UseLentiviralExpressionMammalianPromoterMND/PGKAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cav1.2 pS1928 [L132/80R]
Plasmid#225371PurposeMammalian Expression Plasmid of anti-Cav1.2 (Mouse) IgG2a R-mAb. Derived from hybridoma L132/80.DepositorInsertAnti-Cav1.2 (Mus musculus) recombinant (Mouse) monoclonal antibody. (Cacna1c Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cav1.2 pS1928 [L132/76R]
Plasmid#225370PurposeMammalian Expression Plasmid of anti-Cav1.2 (Mouse) IgG2a R-mAb. Derived from hybridoma L132/76.DepositorInsertAnti-Cav1.2 (Mus musculus) recombinant (Mouse) monoclonal antibody. (Cacna1c Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only