We narrowed to 4,733 results for: GCA
-
Plasmid#227488Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-1-6
Plasmid#227470Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-700bp-USF
Plasmid#227478Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 700bp Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-42kb-USF
Plasmid#227459Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 42kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-36kb-USF
Plasmid#227461Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-36kb-USF
Plasmid#227462Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-20kb-USP
Plasmid#227446Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 20kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
NSL1 C5.4 gRNA
Plasmid#90804Purpose3rd generation lentiviral gRNA plasmid targeting human NSL1DepositorInsertNSL1 (Guide Designation C5.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZWILCH H11.1 gRNA
Plasmid#90945Purpose3rd generation lentiviral gRNA plasmid targeting human ZWILCHDepositorInsertZWILCH (Guide Designation H11.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CENPE C4.1 gRNA
Plasmid#90615Purpose3rd generation lentiviral gRNA plasmid targeting human CENPEDepositorInsertCENPE (Guide Designation C4.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 3- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210739PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 3DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianPromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210747PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 3DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 1- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210741PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 1DepositorInsertsSaSp Cas9
Merry sgRNA GFP Target 1
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ERF922
Plasmid#126883PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Frodo-eCMV-SaSpD10A (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210734PurposeCoding for SaSp D10A Cas9 alongside Frodo sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Frodo sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1- sgCTG Gollum-eCMV-SaSpD10A (Neuron codon optimization)-3XFLAG-SV40 NLS-ITR2
Plasmid#210735PurposeCoding for SaSp D10A Cas9 alongside Gollum sgRNA targeting CAG repeatsDepositorInsertsSaSp D10A Cas9
Gollum sgCAG
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationD10A, N terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330.iGFP3
Plasmid#66583PurposesgRNA for iGFPDepositorInsertiGFP
ExpressionMammalianAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-SYNPO
Plasmid#140587PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA SYNPO
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-CLIC3
Plasmid#140583PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA CLIC3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only