We narrowed to 20,038 results for: omp
-
Plasmid#148255PurposeMammalian Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
UseTagsExpressionMammalianMutationone silent mutation compared to the sequence give…PromoterAvailable sinceNov. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
p2R3a-TagRFP-OcsT
Plasmid#71270PurposeEntry clone containing TagRFP. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTagRFP
UseGatewayTags4xGly linker and octaline synthase terminatorExpressionMutationPromoterAvailable sinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRL838
Plasmid#70680PurposeThis vector was used to generate a library of ca. 17-kb sequences of clones as part of a genomic sequence strategy and were then used to complement mutations.DepositorTypeEmpty backboneUseCre/LoxTagsExpressionMutationPromoterAvailable sinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsDCP1a_G
Plasmid#146400PurposeMammalian Expression of HsDcp1aDepositorInsertHsDcp1a (DCP1A Human)
UseTagsExpressionMammalianMutationtwo silent mutations T237C and G1716T compared to…PromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-HsNot4-GB1His6_AG
Plasmid#148792PurposeBacterial Expression of HsNot4DepositorInsertHsNot4 (CNOT4 Human)
UseTagsExpressionBacterialMutationone silent mutation compared to the sequence give…PromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSL0747 (pDonor_L-MmeI)
Plasmid#130647PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene. The mutated left end introduces an MmeI recognition site (used for Tn-seq). Total transposon size = 977 bp.DepositorInsertVchCAST donor DNA (L*)
UseCRISPR; TransposonTagsExpressionBacterialMutationTGTTGATG --> TGTTGGAGPromoterAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL0746 (pDonor_R-MmeI)
Plasmid#130646PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene. The mutated right end introduces an MmeI recognition site (used for Tn-seq). Total transposon size = 977 bp.DepositorInsertVchCAST donor DNA (R*)
UseCRISPR; TransposonTagsExpressionBacterialMutationTGTTGATA --> TGTTGGAAPromoterAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
Plasmid#210504Purposeexpresses NES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry component in mammalian cellsDepositorInsertNES-TvmvC-43LK-iLID-TvmvN-TVMVseq(P1'S)-mCherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
UseTagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…PromoterAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PatoM-LOG241
Plasmid#72847PurposeInduced by acetoacetate to express GFP using atoSC two-component system in E. coli. Contains the atoDAEB promoter (Pato) with a strong RBS, Shine-Dalgarno sequence provided in OG241. LOG241 backbone.DepositorInsertPatoM
UseTagsExpressionBacterialMutationPromoterPatoMAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
His-MBP-NRBF2 (1-159)
Plasmid#99331PurposeMammalian expression of the monomeric form of NRBF2 that binds with the PI3K C1 complexDepositorInsertNuclear receptor-binding factor 2 (NRBF2 Human)
UseTags6xHis-MBP-TEVExpressionBacterialMutationAA1-159 are presentPromoterT7Available sinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-CCR5
Plasmid#222309PurposeSynchronize the trafficking of CCR5 from the ER.DepositorInsertStreptavidin-KDEL and CCR5 fused to SBP-EGFP (CCR5 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-mCherry-CCR1
Plasmid#222311PurposeSynchronize the trafficking of CCR1 from the ER.DepositorInsertStreptavidin-KDEL and CCR1 fused to SBP-mCherry (CCR1 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGGI_Myr-YFP-MiniTurboID
Plasmid#222432PurposePotential plasma membrane control.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker, Myr, and YFPExpressionMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterAvailable sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT3_mCherry2-NLS-PEST_Puro
Plasmid#213771PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT3_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT4_short_mCherry2-NLS-PEST_Puro
Plasmid#213774PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT4_short_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-HKGT4_mCherry2-NLS-PEST_Puro
Plasmid#213773PurposeFluorescent reporter designed on shortlist of Housekeeping-like signature and transcription factor genes from Tabula Sapiens and Tabula Muris databases.DepositorInsertHKGT4_mCherry2-NLS-PEST
UseLentiviral and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only