We narrowed to 8,613 results for: org
-
Plasmid#104095PurposeExpresses TREAT-siRNA reporter in mammalian cellsDepositorInsertRenilla luciferase
UseTags24xMS2 stem loops in 3'UTR, 24xPP7 stem loop…ExpressionMammalianMutationPromoterAvailable sinceJan. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-173-N-ORAI1
Plasmid#87618PurposeN-terminal Venus (YFP) fragment fused to full-length ORAI1; for BiFC.DepositorInsertVenus173-N-ORAI1 (ORAI1 Human, Synthetic)
UseTags6xHis, T7 tag (gene 10 leader), and Xpress(TM) ta…ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniSOG-Golgi-7
Plasmid#57768PurposeLocalization: Golgi, Excitation: 448 / 473, Emission: 500 / 528DepositorInsertGolgi (B4GALT1 Human)
UseTagsminiSOGExpressionMammalianMutationaa 1-82 of NM_001497.3PromoterCMVAvailable sinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSF4 TetCMV intron Renilla STOP 12xPP7 1xfirefly-siRNA xrRNA12 24xMS2 SV40 CTE polyA
Plasmid#104094PurposeExpresses TREAT reporter in mammalian cellsDepositorInsertRenilla luciferase
UseTags12xPP7 stem loops in 3'UTR, 24xMS2 stem loop…ExpressionMammalianMutationPromoterTetCMVAvailable sinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherTagsExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Str-STIM1-NN_puromycin
Plasmid#65310PurposeLuminal ER hook only (RUSH system)DepositorInsertSTIM1 mutated for binding motif to microtubule (STIM1 Human)
UseTagsstreptavidinExpressionMammalianMutation2 amino acids of STIM1 (IP from SxIP motif) were …PromoterCMVAvailable sinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV intron Renilla STOP 12xPP7 TNFα-ARE xrRNA12 24xMS2 SV40 CTE polyA
Plasmid#104096PurposeExpresses TREAT-ARE reporter in mammalian cellsDepositorInsertRenilla luciferase
UseTags12xPP7 stem loops in 3'UTR, 24xMS2 stem loop…ExpressionMammalianMutationPromoterAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniSOG-LaminB1-10
Plasmid#57771PurposeLocalization: Nuclear Envelope, Excitation: 448 / 473, Emission: 500 / 528DepositorInsertLaminB1 (LMNB1 Human)
UseTagsminiSOGExpressionMammalianMutationPromoterCMVAvailable sinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSF4 TetCMV 5'TOP intron Renilla-STOP 24xPP7 1xfirefly-siRNA xrRNA12 24xMS2 SV40 CTE polyA
Plasmid#104140PurposeExpresses TREAT-5'TOP reporter in mammalian cellsDepositorInsertRenilla luciferase
UseTags24xMS2 stem loops in 3'UTR, 24xPP7 stem loop…ExpressionMammalianMutationPromoterAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DCX(S306D)-2A-mCherry
Plasmid#118292PurposeExpresses human mutant DCX tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Serine at position 306 substituted for aspartic acidDepositorInsertDoublecortin (DCX Human)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationSerine 306 changed to Aspartic AcidPromoterCMV with beta global intronAvailable sinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DCX(S306A)-2A-mCherry
Plasmid#118291PurposeExpresses human mutant DCX tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells. Serine at position 306 substituted for alanineDepositorInsertDoublecortin (DCX Human)
UseAAVTags2A peptide and mCherryExpressionMammalianMutationchanged Serine 306 to AlaninePromoterCMV with beta global intronAvailable sinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-BE4RA-P2A-Puro
Plasmid#112672PurposeLentivirus for constitutive expression of BE4RA in mammalian cells (codon optimized)DepositorInsertBE4RA
UseLentiviralTagsFLAGExpressionMutationNLS sequence at the N-terminus and D10APromoterEF1sAvailable sinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F1-GFP
Plasmid#91881PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorInsertgRNA targeting Suz12 (Suz12 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLC-RFP657-CASP8
Plasmid#75164PurposeLentiCRISPR-RFP657 with sgRNA targeting human Caspase-8DepositorInsertCASP8 sgRNA (CASP8 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g1 (BB22)
Plasmid#139457PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g2 (BB23)
Plasmid#139458PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-BE3RA-P2A-GFP-PGK-Puro
Plasmid#110868PurposeLentiviral vector for constitutive expression of BE3RA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertBE3RA
UseLentiviralTagsExpressionMutationD10APromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1RA-PGK-Puro
Plasmid#110860PurposeLentiviral vector for constitutive expression of Cas9-HF1RA in mammalian cells (codon optimized)DepositorInsertCas9-HF1RA
UseLentiviralTagsFLAGExpressionMutationR661A, Q695A, Q926A, and NLS sequence at the N-te…PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-miniSOG-Actin-7
Plasmid#55085PurposeLocalization: Actin, Excitation: 448 / 473, Emission: 500 / 528DepositorInsertActin (ACTB Human)
UseTagsmCherry-miniSOGExpressionMammalianMutationPromoterCMVAvailable sinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_GP1Fc Cl13
Plasmid#138599PurposeExpresses GP1 of LCMV Cl13 fused with human IgG (Fc fusion)DepositorInsertLCMV GP1-Fc
UseTagsFc fusion proteinExpressionMammalianMutationPromoterCMVAvailable sinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits only