We narrowed to 3,093 results for: FRI
-
Plasmid#159747PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP V107M-L273D-L276D
Plasmid#114183PurposeORAI1 channel with C-terminal YFP, carrying the constitutively activating mutation V107M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP V107M-L273D-L276D (ORAI1 Human)
UseTagsYFPExpressionMammalianMutationV107M/L273D/L276DPromoterAvailable sinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ORAI1-YFP T184M-L273D-L276D
Plasmid#114184PurposeORAI1 channel with C-terminal YFP, carrying the activating mutation T184M from TAM, and the mutations L273D-L276D leading to a deficiency in STIM1-mediated gating.DepositorInsertORAI1-YFP T184M-L273D-L276D (ORAI1 Human)
UseTagsYFPExpressionMammalianMutationT184M/L273D/L276DPromoterAvailable sinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
10xHis-ataxin-3 *SIM-HA
Plasmid#89983PurposeExpresses His- and HA-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorInsertataxin-3 (ATXN3 Human)
UseTags10xHis and HAExpressionMammalianMutationmutated aa 162IFVV to 162AFAAPromoterAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 *SIM
Plasmid#89979PurposeExpresses GFP-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorInsertataxin-3 (ATXN3 Human)
UseTagsGFPExpressionMammalianMutationmutated 162IFVV to 162AFAAPromoterAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 *VBM
Plasmid#89976PurposeExpresses GFP-tagged ataxin-3 with a mutation in the VCP-binding motifDepositorInsertataxin-3 (ATXN3 Human)
UseTagsGFPExpressionMammalianMutationmutated 282RKRR to 282HNHHPromoterAvailable sinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T645A
Plasmid#74936PurposeMammalian expression of human NSF mutant T645A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
UseTagsFLAGExpressionMammalianMutationT645A (mutation in the D2 domain of the protein)PromoterCMVAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
HNF4A_P2-198
Plasmid#31065DepositorInsertHNF4A P2 promoter (HNF4A Human)
UseLuciferaseTagsExpressionMammalianMutation-198 to -1 of P2 HNF4A promoterPromoterAvailable sinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
PCR4-Shh::lacZ-H11
Plasmid#139098PurposeenSERT LacZ reporter vector for site-specific integration into the H11 locus (contains Shh minimal promoter)DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterShhAvailable sinceMarch 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PCR4-Hsp68::lacZ-H11
Plasmid#139099PurposeenSERT LacZ reporter vector for site-specific integration into the H11 locus (contains Hsp68 minimal promoter)DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterHsp68Available sinceMarch 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDule2-3-nitroTyrosine (A7)
Plasmid#174079PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the third generation Mj 3NY (A7) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
UseTagsExpressionBacterialMutationY32H H70T D158H I159A L162RPromoterGlnRS (constitutive)Available sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3 ss-3xFLAG-hLRP5 (aa 32-1615)
Plasmid#115788PurposeExpresses human LRP5 with N-terminal 3xflag tag in mammalian cells, contains artificial signal sequence upstream of tag.DepositorInsertLRP5 (LRP5 Human)
UseTags3xflagExpressionMammalianMutationcontains silent mutation that creates an internal…PromoterCMVAvailable sinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
GABA(A) receptor subunit a2SE
Plasmid#49169PurposepHluorin-tagged GABA A receptor subunit (alpha 2) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit alpha-2 (GABRA2 Human)
UseTagsHA, bovine alpha 1 signal sequence, and pHGFP (pH…ExpressionMammalianMutationT343APromoterCMVAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hygro-2xMyc-Rac1-P29S
Plasmid#128581PurposeFor mammalian cell expression of P29S mutant murine RAC1 carrying 2x Myc epitope tag sequences at the N-terminus.DepositorInsertRac1 (Rac1 Mouse)
UseRetroviralTags2xMyc epitopeExpressionMammalianMutationChanged Proline29 to Serine.PromoterAvailable sinceAug. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDule-3-nitroTyrosine (A7)
Plasmid#174078PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the third generation Mj 3NY (A7) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
UseTagsExpressionBacterialMutationY32H H70T D158H I159A L162RPromoterGlnRS (constitutive)Available sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICE-HA-Ku70-siR-Mut6E
Plasmid#82330PurposePlasmid for constitutive or doxy-inducible expression of mutant human Ku70 unable to bind DNA and resistant to siRNA. Confers resistance to puro. Use T-REx cells for doxycycline-inducible expression.DepositorInsertKu70 (XRCC6 Human)
UseTagsHAExpressionMammalianMutationMut6E corresponding to K282E K287E T300E K331E K3…PromoterCMV-tetAvailable sinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cherry-HA-KCC2
Plasmid#104077PurposeTo visualize the expression and localization of potassium-chloride cotransporter type 2 (KCC2)DepositorInsertKCC2 (b isoform) (Slc12a5 Rat)
UseTagsmCherry-HA tagExpressionMammalianMutationEcoR1 site in rat KCC2 was removed by silent muta…PromoterUbCAvailable sinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
B2M Bulldozer (gRNA crB2M_13)
Plasmid#84381PurposeThis plasmid expresses a gRNA targeting the first exon of human B2M. Most efficient gRNA targeting B2M, leading to ablation of B2M and MHC class I surface expression in 50% of transfected cellsDepositorInsertB2M Bulldozer crB2M_13 gRNA
UseTagsExpressionMammalianMutationPromoterhU6 promoterAvailable sinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only