We narrowed to 9,206 results for: sgRNA
-
Plasmid#242892PurposePiggyBac cargo vector with HNRNPL sgRNA 3 for dox-inducible knockdownDepositorPublicationAvailable sinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only
-
PB_rtTA_BsmB-YTHDC1_sgRNA_4
Plasmid#242893PurposePiggyBac cargo vector with YTHDC1 sgRNA 4 for dox-inducible knockdownDepositorPublicationAvailable sinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-YTHDC1_sgRNA_2a
Plasmid#242894PurposePiggyBac cargo vector with YTHDC1 sgRNA 2a for dox-inducible knockdownDepositorPublicationAvailable sinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196988PurposeDerived from pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP, custom sgRNA cloning vectorDepositorInsertNestin-dCas9-KRAB-T2a-GFP
UseCRISPR and LentiviralAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHB
Plasmid#177981Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHBDepositorInsertsgRNA targeting SDHB (SDHB Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFH113
Plasmid#128210Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorAvailable sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-AAVS1-sgRNA
Plasmid#194723Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target hAAVS1DepositorAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_CDC45
Plasmid#244243PurposeExpresses SpCas9 and a sgRNA targeting the human CDC45 loci for knock-in.DepositorAvailable sinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT112)
Plasmid#181791PurposeExpresses 3-component ShHELIX containing a Cas12k-TniQ-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ-ShTniQ
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Sa sgRNA expression vector
Plasmid#107720PurposeFor in vitro transcription of Sa sgRNA from the T7 promoter.DepositorTypeEmpty backboneUseCRISPRAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hNTa1-qgRNA-pYJA5
Plasmid#217779PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-sgH11-eCas9-T2A-BlastR
Plasmid#172492PurposeFor CRISPR-assisted HDR, Hipp11 locusDepositorInsert, BlastR and sgRNA targeting the Hipp11 (H11) safe harbor locus
UseCRISPR, Lentiviral, and Mouse TargetingAvailable sinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-SpCas9-HF1 (without sgRNA; with silent mutations)
Plasmid#126755PurposeExpression plasmid for human codon-optimized increased fidelity SpCas9-HF1 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSpCas9-HF1
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
HaloXRCC4 sgRNA
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only