165,839 results
-
Plasmid#112718PurposeExpresses YFP-KRAS4B fusion protein used for FRET studies in eukaryotic cells.DepositorAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pCAG-OSF-PP-human-CHMP3
Plasmid#154180Purposeexpresses human CHMP3 in mammalian cellsDepositorInsertCHMP3 (CHMP3 Human)
UseTagsFLAG and Strep-Tag IIExpressionMammalianMutationPromoterCAGAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-ChR2-EYFP
Plasmid#183765PurposeThis plasmid is for use with neuronal cell-type selective activity tagging. The ChR2-EYFP expression requires both neural activity and Cre recombinase.DepositorInsertAAV transgene -teto promoter-flex/dio-ChR2-EYFP
UseAAV, Cre/Lox, and Mouse TargetingTagsChR2-EYFPExpressionMammalianMutationPromotertetO promoterAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-Hygro-amp-sgRNA-resistant PBRM1
Plasmid#107407PurposeLentiviral expression of gRNA resistant PBRM1DepositorInsertsg resistant PBRM1 (PBRM1 Human)
UseLentiviralTagsExpressionMutationsgRNA resistantPromoterAvailable SinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
CLYBL hOPM
Plasmid#112499PurposeHomologous recombination vector for dox-inducible overexpression of OTX2, PAX6, and MITF in CLYBL locusDepositorUseTagsExpressionMammalianMutationPromoterTRE3GAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLysscys255
Plasmid#36429DepositorInsertSaporin-3/cys255
UseTagsExpressionBacterialMutationcys added at position 255PromoterT7Available SinceMay 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-pdh_RiboJ_mCherry_Bba_B0015
Plasmid#107581PurposeB. megaterium DSM319 pdh promoter, mCherry (Bacillus codon optimised) for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertmCherry
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterpdh promoter Bacillus megaterium DSM319Available SinceApril 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_DDIT3_WT
Plasmid#82107PurposeGateway Donor vector containing DDIT3 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-TEV-mDvl2PDZ(264-353)_pCDFduet
Plasmid#216386PurposeBacterial expression vector for MBP-tagged mouse Dvl2 PDZ domain (residues 264-353)DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET23b-15F11-HA-mEGFP-6xHis
Plasmid#129593PurposeThe encoded protein is the anti-HA scFv (anti-HA frankenbody) fused with the mEGFP and His-tag. This plasmid is for bacteria protein expression under T7 promoter and protein purification with HisTrap.DepositorInsertAnti-HA frankenbody-mEGFP (15F11-HA scFv-mEGFP)
UseTags6xHis-tagExpressionBacterialMutationPromoterT7Available SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMito-MtrxRFP2
Plasmid#172324Purposefluorescent biosensor for the redox of mitochondrial specific thioredoxin (Trx2)DepositorInsertmitochondrial expression of human thioredoxin 2, fused with a redox-sensitive RFP through Gly-Ser-rich linker
UseTagsHis-tag and Mitochondria localization sequenceExpressionMammalianMutationPromoterCMV, SP6Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKSJ376
Plasmid#103065PurposeExpresses colicin E1 with R domain deletion and ImmE1DepositorUseTagsExpressionBacterialMutationR (receptor-binding domain) deletion in colicin E…PromoterT7 lac (from pET) and T7 lac (from pET52-b)Available SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_CD WT TET1
Plasmid#124082PurposeExpression of wild-type catalytic domain only form of TET1DepositorInsertTET1 catalytic domain (TET1 Human)
UseTagsFlag and HAExpressionMammalianMutationPromoterEF1 alphaAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2R3z-AtU3b-tRNA-ccdB-gRNA
Plasmid#118390PurposeEntry clone expressing gRNA. Target site can be introduced between tRNA and gRNA backbone. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertAtU3b promoter
UseCRISPRTagsExpressionMutationPromoterAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmEGFP-DRD2
Plasmid#190752PurposeExpression of DRD2 with mEGFP tag on N-terminus.DepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-iGlu3Fast
Plasmid#226500PurposeUltrafast-decay iGluSnFR3 variant for tracking high frequency synaptic glutamate releaseDepositorInsertiGluSnFR3 S72T
UseTagsIgK, Myc tag, and PDGFR Beta TM domainExpressionMammalianMutationS72TPromoterCMVAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
HPSE-bio-His
Plasmid#53407PurposeExpresses full-length Heparanase precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertHPSE (HPSE Human)
UseTagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
T7-pAc5.1 mCherry EcoRV
Plasmid#206490PurposeSchneider cell imagingDepositorTypeEmpty backboneUseTagsmCherryExpressionInsectMutationPromoterAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
RabV CVS-N2c(deltaG)-FlpO
Plasmid#73473PurposeExpresses FlpO for circuit mapping and genetic manipulationDepositorInsertFlpO
UseNeurotropic virusTagsExpressionMutationPromoterAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only