We narrowed to 11,169 results for: ENA
-
Plasmid#103436PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-324-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-324-5p target (MIR324 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-484
Plasmid#103552PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-484 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-484 target (MIR484 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Promoter Only Target
Plasmid#127669PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter as well as 2 gRNAs targeting the Zfp462 promoter expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 115 and 117
UseCRISPRTagsHAExpressionMammalianMutationPromoterEF1a and hU6Available sinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-15b-5p
Plasmid#103269PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-15b-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-15b-5p target (MIR15B Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-17-5p
Plasmid#103274PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-17-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-17-5p target (MIR17 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-510-3p
Plasmid#103592PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-510-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-510-3p target (MIR510 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-339-3p
Plasmid#103452PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-339-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-339-3p target (MIR338 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-376c-5p
Plasmid#103500PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-376c-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-376c-5p target (MIR376C Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-340-5p
Plasmid#103459PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-340-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-340-5p target (MIR340 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-30e-5p
Plasmid#103419PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-30e-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-30e-5p target (MIR30E Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-615-5p
Plasmid#103675PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-615-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-615-5p target (MIR615 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-377-3p
Plasmid#103501PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-377-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-377-3p target (MIR376C Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-34a-5p
Plasmid#103465PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-34a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-34a-5p target (MIR34A Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-377-5p
Plasmid#103502PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-377-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-377-5p target (MIR377 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-203a-3p
Plasmid#103336PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-203a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-203a-3p target (MIR203A Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-505-3p
Plasmid#103583PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-505-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-505-3p target (MIR505 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-1307-3p
Plasmid#103214PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-1307-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-1307-3p target (MIR1307 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-17-3p
Plasmid#103273PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-17-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-17-3p target (MIR17 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-23a-5p
Plasmid#103372PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-23a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-23a-5p target (MIR23A Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-200b-3p
Plasmid#103330PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-200b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-200b-3p target (MIR200B Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRERRA-P2A-GFP-PGK-Puro
Plasmid#110865PurposeLentiviral vector for constitutive expression of Cas9-VRERRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VRERRA
UseLentiviralTagsFLAGExpressionMutationD1135V, G1218R, R1335E, T1337R, and NLS sequence …PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-zeo: alpha6mGFP
Plasmid#35611Purposemammalian expression of mouse Alpha6 (Chrna6) with internal mEGFP tagDepositorInsertnAChr alpha6mEGFP (Chrna6 Mouse)
UseTagsmEGFP inserted after A405 with AGA linker on eith…ExpressionMammalianMutationPromoterCMVAvailable sinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO NET1A-V5 S46A
Plasmid#69829PurposeExpresses NET1A-V5 in mammalian cells in a doxycycline inducible mannerDepositorInsertNeuroepithelial cell-transforming gene 1 protein A (NET1 Human)
UseLentiviralTagsv5ExpressionMammalianMutationS46APromoterminimal CMV promoter with tetracycline operatorAvailable sinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMV-FFluc-GPD1L-3'UTR Full mut
Plasmid#32489DepositorInsertGPD1L 3'UTR (Gpd1l Mouse)
UseTagsLuciferaseExpressionMammalianMutationMutated in the entire miR-210 binding regionPromoterCMVAvailable sinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FLAG-RGS14
Plasmid#236567PurposeExpresses Flag-RGS14 in mammalian cellsDepositorInsertHomo sapiens regulator of G-protein signaling 14 (RGS14 Human)
UseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgZmat3.1
Plasmid#227943PurposesgRNA targeting Zmat3, GFP, neomycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPRDepositorInsertZmat3.1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhuman U6Available sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgZmat3.2
Plasmid#227944PurposesgRNA targeting Zmat3, GFP, neomycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPRDepositorInsertZmat3.2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhuman U6Available sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_R-PTEN_4A
Plasmid#227435PurposeExpression of the R-PTEN sensor with a 4A mutationDepositorInsertR-PTEN 4A (Pten Rat)
UseTagsmCyRFP2, mMaroonExpressionMammalianMutationPromoterCMVAvailable sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG_G-PTEN
Plasmid#227436PurposeExpresses the G-PTEN sensor under a CAG promoterDepositorInsertG-PTEN sensor, mEGFP-PTEN-sREACh (Pten Rat)
UseTagsmEGFP, and sREAChExpressionMammalianMutationR14GPromoterCAGAvailable sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX330-PTEN
Plasmid#227440PurposeCas9 expression and a gRNA targeting Exon 6 of mouse PTENDepositorInsertspCas9 and gRNA for mouse PTEN (Pten )
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_R-PTEN
Plasmid#227433PurposeExpresses the R-PTEN sensor under a CMV promoterDepositorInsertR-PTEN (Pten Rat)
UseTagsmCyRFP2, mMaroonExpressionMammalianMutationR14GPromoterCMVAvailable sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_G-PTEN_4A
Plasmid#227434PurposeExpresses the G-PTEN sensor with a 4A mutationDepositorInsertG-PTEN 4A (Pten Rat)
UseTagsmEGFP and sREAChExpressionMammalianMutation4A mutation.PromoterCMVAvailable sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC131_CCR5(SFFV-synEPOR-2A-YFP)
Plasmid#232412PurposeAAV production plasmid for SFFV(synEPOR) vector from Figs. 2-3 that mediates HDR at CCR5 locus using CCR5 gRNA. YFP is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorInsertTruncated Erythropoietin Receptor (EPOR Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC175_HBA1reg(synEPOR)
Plasmid#232413PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank H+C15BA1 cassette. HAs are ~400bp each.DepositorInsertTruncated Erythropoietin Receptor (EPOR Human)
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CB-Cdkn1a
Plasmid#228914PurposeExpression CDKN1A in mammalian cellsDepositorInsertCdkn1a (Cdkn1a Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-YFP-CAAX-IRES*-GINIP-Nluc W139A
Plasmid#223560PurposeAlias: Gαi bONE-GO W139A. Lentiviral vector expressing GINIP-Nluc W139A after a low efficiency IRES downstream of YFP-CAAX placed after the promotorDepositorInsertYFP(Venus) - KRas4b - IRES* - human GINIP W139A - linker(GGGS) - Nluc
UseLentiviralTagsExpressionMammalianMutationW139A mutation in GINIP sequencePromoterCMVAvailable sinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRpuro-sgSEC24D
Plasmid#231565PurposepLentiCRISPR expression vector for Cas9 and gRNA targeting human SEC24D (Puromycin selection marker)DepositorInsertsgSEC24D (SEC24D Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6, EF-1aAvailable sinceFeb. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMVP-SEC24C
Plasmid#231559PurposepMVP expression vector for human SEC24C (wild type, closed, resistant to sgSEC24C #1 and #2) (Blasticidin selection marker)DepositorInsertSEC24C (SEC24C Human)
UseLentiviralTagsV5ExpressionMammalianMutationsilent PAM mutations (G67 (GGG>GGA) and A115 (…PromoterCMVAvailable sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ E4F1 degron(220-242)-GFP-IRES-mCherry
Plasmid#231007PurposeProtein stability reporter construct for E4F1 consisting of aa 220-242 for transient overexpression in mammalian cells.DepositorInsertE4F1 aa220-242 (E4F1 Human)
UseTagsAcGFP1ExpressionMammalianMutationPromoterAvailable sinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-30nmEML-mRFP
Plasmid#231182PurposeExpresses a synthetic linker, tagged with mRFP, stabilizing the ER-mitochondrial distance at 30 nm from a lentiviral vectorDepositorInsert30nmEML-mRFP
UseLentiviralTagsExpressionMutationPromoterCMVAvailable sinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-CDKN1A
Plasmid#228912PurposeExpression CDKN1A in mammalian cellsDepositorInsertCdkn1a (Cdkn1a Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-shCdkn1a(#4)
Plasmid#228913PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertshCdkn1a (Cdkn1a Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 sequence: GTCGCTACCTACAGCCAGGA, Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i1-ipUSEPR-TR657
Plasmid#228953PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i1 (Cdkn1a Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i2-ipUSEPR-TR657
Plasmid#228954PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i2 (Cdkn1a Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcs2-cDELE1(142-515)-sumo
Plasmid#226107PurposecDELE1 (corresponding to mitochondrially imported, cleaved DELE1, residues 142-515) fused to sumo used for in-vitro translation by wheat germ extract in in-vitro ubiquitylation assaysDepositorInsertDELE1 (DELE1 Human)
UseTagsSumoExpressionMammalianMutationencodes only residues 142-515 of DELE1 (represent…PromoterAvailable sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-MTS-cox8A-GFP-IRES-mCherry
Plasmid#226103PurposeStability reporter construct of the COX8A mitochondrial targeting sequence (MTS) for transient expression in mammalian cellsDepositorInsertCOX8A (COX8A Human)
UseTagsGFPExpressionMammalianMutationencodes only for mitochondrial targeting sequence…PromoterAvailable sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcs2-cDELE1(142-515)-GFP-IRES-mCherry
Plasmid#226102PurposecDELE1 (corresponding to mitochondrially imported, cleaved DELE1, residues 142-515) stability reporter construct for transient expression in mammalian cellsDepositorInsertDELE1 (DELE1 Human)
UseTagsGFPExpressionMammalianMutationonly encodes for residues 142-515 of DELE1 corres…PromoterAvailable sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28b-ptetO::bac::gfp
Plasmid#217882Purposeexpresses the bac-BGC in bacterial cells, produces bacillamide DDepositorInsertsDehydrogenase
Non-ribosomal peptide synthetase
Aminotransferase
UseTagsExpressionBacterialMutationPromoterptetOAvailable sinceSept. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK_ACE2-ECD_Notch-Gal4VP64 (pZYW037)
Plasmid#194226PurposeLentiviral expression vector expressing ACE2-ECD SynNotch and mCherry transduction markerDepositorInsertPGK-ACE2-SynNotch-T2A-mCherry (ACE2 Synthetic)
UseLentiviralTagsExpressionMutationPromoterPGKAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only