We narrowed to 3,455 results for: biorxiv
-
Plasmid#251727PurposeExpression of Cre-dependent binding mutant control calcium lifetime sensor LifeCamp0 under hSyn promoter in pAAV backboneDepositorInsertLifeCamp0
UseAAVExpressionMammalianAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTE_10 - pCMV-Cas9_only
Plasmid#252006PurposeMammalian expression of Cas9DepositorInsertCas9
UseCRISPRExpressionMammalianMutationNAAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-RiboL1-LifeCamp
Plasmid#251728PurposeExpression of soma-targeted calcium lifetime sensor LifeCamp under hSyn promoter in pAAV backboneDepositorInsertRiboL1-LifeCamp
UseAAVExpressionMammalianAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPU_sgRNA_5
Plasmid#242900PurposePiggyBac cargo vector with HNRNPU sgRNA 5 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPU_sgRNA_1
Plasmid#242901PurposePiggyBac cargo vector with HNRNPU sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-HNRNPU_sgRNA_3
Plasmid#242902PurposePiggyBac cargo vector with HNRNPU sgRNA 3 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pINEAPLE
Plasmid#250295PurposeBig-IN Payload assembly vector by Golden Gate Cloning using Esp3I. Contains a bacterial green/white GFP-based screening system and a mammalian transient (backbone) BSD selection cassette.DepositorInsertSuperfolderGFP
UseSynthetic Biology; Assembly vector for big-in pay…Available SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
UbSYHRE_pDONR201
Plasmid#249817PurposeEncodes UbSYHRE (UBQ-HRE1-GAL4STE12), Gateway compatible as Donor plasmidDepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBA1751
Plasmid#246066PurposeBacterial expression of Panoptes locus with 300bp of context upstream and 150bp downstream of the ECOR31 operon cloned under the pJex promoter; SC101 oriDepositorInsertPanoptes locus
ExpressionBacterialPromoterpJEX promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBA1729
Plasmid#246063PurposeBacterial expression of Panoptes locus with 300bp of context upstream and 150bp downstream of the ECOR31 operon cloned under the pTet promoter; p15a oriDepositorInsertPanoptes locus
ExpressionBacterialPromoterpTet promoterAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆7
Plasmid#245367PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆7 (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation7-bp deletion, H96Vfs*29PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆8
Plasmid#245368PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆8 (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutationsynthetic 8-bp deletionPromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆59
Plasmid#245365PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆59 (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation59-bp deletion, D78Vfs*6PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆11
Plasmid#245366PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆11 (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation11-bp deletion, H96Wfs*4PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVBL0001
Plasmid#242429PurposeStable genomic integration of Opto-IRE1 (HsIRE1dLD-mCherry-CRY2clust) using the Flp-in system.DepositorInsertIRE1alpha (ERN1 Human)
TagsmCherry, CRY2clustExpressionMammalianMutationDeletion of the lumenal domainPromoterCMV, tet-inducibleAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donor
Plasmid#221838PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoform D) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformBFH)-7xsfGFP11-HA-HDR-donor
Plasmid#221839PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoforms BFH) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only