We narrowed to 11,287 results for: aga
-
Plasmid#177234PurposeExpresses Neomycin (bU6), Nuak1 (mU6) and Nuak2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNuak1/sgNuak2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_PDR12
Plasmid#166093PurposePlasmid for constituive spCas9 and tet-inducible PDR12 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK139
Plasmid#73315PurposePas2p peroxisomal membrane biogenesis proteinDepositorInsertPas2p peroxisomal membrane targeting protein
TagsHis6 and c-mycExpressionYeastMutationEncodes a glycine-204 to serine mutationPromoterAOX1Available SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBCPB+
Plasmid#18940DepositorInsertattP, lacZ, attB
ExpressionBacterialAvailable SinceAug. 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
Lentiviral sgRNA human CD19
Plasmid#155289PurposeLentiviral expression of sgRNA against human CD19DepositorInsertCD19 (CD19 Human)
Available SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTorPE-GR-GECO1.2
Plasmid#42199DepositorInsertGR-GECO1.2
Tags6HisExpressionBacterialPromoteraraBADAvailable SinceFeb. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTorPE-GR-GECO1.1
Plasmid#42198DepositorInsertGR-GECO1.1
Tags6HisExpressionBacterialPromoteraraBADAvailable SinceFeb. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shDLST #2
Plasmid#242709PurposeshRNA knockdown human DLST geneDepositorInsertDLST (DLST Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-ACE2-A2
Plasmid#188687PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL22A
Plasmid#166079PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL22A for double stranded break formation in yeast.DepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMBD1.1.0-gDNA
Plasmid#132444PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertMBD1 (MBD1 Human)
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-GST
Plasmid#42049DepositorInsertGST
TagsHisExpressionBacterialAvailable SinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
Plasmid#140082PurposeEntry cloning vector for in vitro transcription or expression of SpCas9 sgRNAs from a T7 promoterDepositorInsertpT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
UseIn vitro transcription (mrna synthesis)ExpressionBacterialPromoterT7Available SinceOct. 17, 2020AvailabilityAcademic Institutions and Nonprofits only