We narrowed to 4,570 results for: erf
-
Plasmid#134710PurposeLentiviral expression of human MEFV M694I after doxycycline administrationDepositorAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only
-
p21-S208C/M694V-MEFV
Plasmid#134709PurposeLentiviral expression of human MEFV S208C/M694V after doxycycline administrationDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagMutationp.S208C/M694VPromoterTRE2 (Dox-inducible)Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
p21-M694V-MEFV
Plasmid#134703PurposeLentiviral expression of human MEFV M694V after doxycycline administrationDepositorAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-H3
Plasmid#124435PurposeChimeric ETS domain: H3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis TagExpressionBacterialMutationResidues 225 to 239 replaced with corresponding s…Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-Loop
Plasmid#124551PurposeChimeric ETS domain: Loop of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 216 to 223 replaced with corresponding s…Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-H3/S3
Plasmid#124627PurposeChimeric ETS domain: H3/S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 237 to 241 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-S3
Plasmid#124550PurposeChimeric ETS domain: S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 242 to 246 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28b-PU.1-ETS-H2
Plasmid#123358PurposeChimeric ETS domain: H2 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 207 to 215 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
tdEos-EB3-7
Plasmid#57610PurposeLocalization: MT End Binding Protein, Excitation: 505 / 569, Emission: 516 / 581DepositorAvailable SinceJan. 16, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS-CD4-YEML-myc
Plasmid#58538PurposeExpresses human CD4 with the IFITM3 endocytosis motif (YEML) and a C-terminal myc tag in mammalian cells.DepositorInsertCD4 (CD4 Human)
TagsIFITM3 endocytosis Tyrosine-Glutamate-Methionine-…ExpressionMammalianMutationAdded C-terminal Tyrosine-Glutamate-Methionine-Le…Available SinceSept. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
EcM2.1
Bacterial Strain#64052PurposeOptimized strain for high-efficiency genome manipulations using CoS-MAGE and tolC cyclingDepositorBacterial ResistanceAmpicillinAvailable SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNK3071
Plasmid#219755PurposeMoClo-compatible Level P vector for improved autonomous bioluminescence in plants encoding kanamycin resistance cassette, mcitHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH.DepositorInsertmcitHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH
ExpressionPlantAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK497
Plasmid#219754PurposeMoClo-compatible Level P vector for improved autonomous bioluminescence in plants encoding kanamycin resistance cassette, nnHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH.DepositorInsertnnHispS, NpgA, nnH3H_v2, nnLuz_v4 and nnCPH
ExpressionPlantAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
CLYBL-TO-hNGN2-BSD-mApple
Plasmid#124229PurposeTargets the human CLYBL safe harbor locus for integration of dox-inducible NGN2 for differentiation of iPSCs into cortical neurons. Contains a floxed BSD-NLS-mApple selection cassette.DepositorInsertNGN2 (NEUROG2 Human)
ExpressionMammalianAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐hsRNASEH2BCA
Plasmid#108692PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A, allowing affinity purification of the RNase H2 trimeric enzymeDepositorTagsGSTExpressionBacterialMutationShine Dalgarno sequence upstream of start codon a…PromotertacAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐hsRNASEH2BCA(D34A/D169A)
Plasmid#108693PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A (with D34A and D169A catalytic site mutations) for purification of the RNase H2 trimeric enzymeDepositorTagsGSTExpressionBacterialMutationShine Dalgarno sequence upstream of start codon, …PromotertacAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-DreO-bGHpA
Plasmid#50363PurposeCan be used to generate AAV virus that will express DreO recombinase in neurons from the synapsin promoterDepositorHas ServiceAAV Retrograde and AAV5InsertDreO recombinase
UseAAVTagsnoneMutationSequence optimized for expression in mammalian ce…PromoterhSyn1Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP7b
Plasmid#104484PurposeMammalian expression of ultrasensitive protein calcium sensorDepositorInsertjGCaMP7b
TagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP7s
Plasmid#104463PurposeMammalian expression of ultrasensitive protein calcium sensorDepositorInsertjGCaMP7s
TagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only