We narrowed to 639 results for: erf
-
TypeCollection...Plasmid Collections Empty Backbones Choosing Your Perfect Plasmid Backbone Empty backbones are plasmids containing...
-
Protocol - How to Perform a Diagnostic Digest
TypeProtocol...Protocol for how to perform a diagnostic digest to verify plasmid size, verify insert orientation, and...expected sizes. This is frequently done after performing either PCR - or restriction enzyme -based cloning... -
Protocol - How to Perform Sequence Analysis
TypeProtocol...Best practices for performing sequence analysis of a plasmid... -
10 Steps to a Perfect Science Talk
TypeBlog Post...of experimental results in the order they were performed does not make for a memorable presentation anywhere... just plan to reuse a prepared talk unless it perfectly fits the occasion. I speak on the same topics... -
Choosing Your Perfect Empty Backbone
TypeBlog Post..., or knocking down YGOI through RNA-mediated interference (e.g. L4440) and observing the downstream effects...additional details and guidance for choosing your perfect plasmid backbone. Or just ask – leave a message... -
Plasmids 101: Expressing shRNAs for RNA Interference
TypeBlog Post...preferred method for many labs. However, RNA interference (RNAi) remains steadfast in the background, ..., a handy “oldie” as you might say. RNA interference (RNAi) is, as the name might suggest, an RNA-mediated...most popular choices for gene silencing. RNA interference RNAi is a useful tool to investigate the roles...-RNA (miRNA) Short hairpin RNA (shRNA) Short interfering RNA (siRNA) Piwi-interacting RNA (piRNA) miRNA..._module_attribute %}{% end_module_block %} Interfering in the future While RNAi has retreated a bit ...Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans...Additional resources on the Addgene blog RNA Interference in Plant Biology: New Tools for an Old Favorite... -
Finding Your Perfect Job After University
TypeBlog Post...themselves. Here is my experience looking for the perfect job. Summer work experience in cancer research... good job to list on my CV. Three months was a perfect duration for me because it was sufficient to figure...University of Queensland in Australia, this was a perfect opportunity to work in a genetics lab. As a UK ...acidemia to have the best chance of finding their perfect job. Resources at Addgene Read Additional Career... -
Performing In Vivo CRISPR Screens Using the FITS Approach
TypeBlog Post...microenvironments. These screens have primarily been performed in activated T cells, precluding analyses of T...cells. More broadly, this system can be used to perform in vivo screens in other cell types. A key feature...in vivo screens. Figure 1: Using FITS to perform in vivo CRISPR screens to assess T cell responses... -
RNA Interference in Plant Biology: New Tools for an Old Favorite
TypeBlog Post...that function downstream of DNA, such as RNA interference, can reversibly exert their effect independent...independent of gene copy number. RNA interference (RNAi) is a conserved eukaryotic process where approximately...DCL) process the dsRNA into specific types of interfering RNAs. RNAi vs. CRISPR: Complementary techniques...from a long hpRNA trigger, only a single ~21-nt interfering RNA is produced using shRNA/amiRNA. Although ...Hiwatashi Y, Goshima G (2012) An Inducible RNA Interference System in Physcomitrella patens Reveals a Dominant...Doudna JA (2013) Molecular Mechanisms of RNA Interference. Annu Rev Biophys 42:217–239 . https://doi.org... -
Proximity Labeling: A Powerful Tool for Protein Complex Purification and Proteomic Mapping
TypeBlog Post...developed in 2012, proximity labelling has become a powerful technique for studying protein-protein interactions... -
CRISPR 101: Engineering the Plant Genome Using CRISPR/Cas9
TypeBlog Post...Cas9-Targeted Mutagenesis of the ERF Transcription Factor Gene OsERF922. PLoS ONE 11:e0154027 . https:/... -
Immunology Research Plasmids and Resources
TypeCollection...IFNA10 interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha...IFNA16 interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha ...MGC142200 IFNA5 interferon, alpha 5 INFA5 IFNA6 interferon, alpha 6 - IFNA7 interferon, alpha 7 IFNA-J IFNA8... -
Validated gRNA Sequences
TypeCollection... 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic GACAGAACGATGCGCTGAAT 68898 interfere S. pyogenes... 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes...AAACAAAACCTCATCAGGCA 68900 interfere S. pyogenes 26918244 Lu PcfiA GAAGCTCACTCCTTAGCACG 68899 interfere S. pyogenes ...74066 interfere S. pyogenes 26829286 Lu pgi C. glutamicum TTGCCTGGAAGTTTGAGTAATGAT 74067 interfere S. pyogenes...74068 interfere S. pyogenes 26829286 Lu pck C. glutamicum TCCAGTTCAGCAGTTCCTTATTCT 74069 interfere S. pyogenes...74070 interfere S. pyogenes 26829286 Lu pyk C. glutamicum ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes.... thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes 26918244 Lu BT1854 B. thetaiotaomicron... -
Viral Production
TypeCollection...protocols and performing rigorous quality control (QC). The specific QC experiments performed varies for ...of Pennsylvania Vector Core. Transfections are performed using the transfer plasmid, a plasmid encoding...and stored at -80 °C. Titer Titering is either performed by Addgene or by the University of Pennsylvania...Pennsylvania Vector Core. In general, titering is performed by the facility that produced the viral vector lot....Pennsylvania Vector Core is (as of April 2016) also performed by droplet digital PCR (ddPCR). Quality Control.... To learn which specific QC experiments were performed on your lot, please contact us . Full sequencing...the Viral Genome Next-generation sequencing is performed on viral genomes isolated from the final AAV preparation... -
Plan Your Experiment
TypeCollection...Activation/interference Needs good primer design Western blot Knockouts Activation/interference Needs a ... nterspaced S hort P alindromic R epeats) is a powerful system that enables researchers to manipulate ...Selecting the genetic manipulation you plan to perform will help you narrow down which components you’...optimization can be challenging Prime Edit Repress or Interfere (CRISPRi) Reduce gene expression without permanently...effective than dCas9 alone for mammalian cell lines Interfere Activate (CRISPRa) Increase gene expression without...be effective, as the Cas9 bound to the DNA can interfere with transcription elongation. CRISPR Activation...between on-target and off-target activity. In a perfect world, your gRNA sequence would be an exact complement... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...vector, but their function (cut, nick, activate, interfere, etc.) is limited to that of the Cas protein present...have plasmids with Cas9 that can cut, activate, interfere, or nick. Selection , such as Puromycin or EGFP...Joung pCRISPathBrick 65006 Bacteria BsaI yes, interfere S. pyogenes Koffas BPK764 65767 Bacteria BsaI ...pyogenes Joung MSP712 65768 Bacteria BsaI yes, interfere S. pyogenes Joung sgRNA with U6 promoter 48962...pyogenes Bar Chen pBUN6I11 50580 Plant BsaI yes, interfere S. pyogenes Bar Chen pBUN411 50581 Plant BsaI ...pyogenes Hyg Chen pHSN6I01 50587 Plant BsaI yes, interfere S. pyogenes Hyg Chen pHSN501 50589 Plant BsaI ... -
Mammalian RNAi Tools
TypeCollection...Plasmids for mammalian RNA interference (RNAi) experiments at Addgene; browse by constitutive lentiviral...Tools for RNAi Browse Plasmids Resources RNA interference (RNAi) is an RNA-mediated gene silencing mechanism...as shRNA (short hairpin RNA) or siRNA (short interfering RNA). Delivery can occur via transfection or ...below. Figure 1: Overview of shRNA-mediated RNA interference. Created with BioRender.com. shRNA Plasmids ... Tuning silence: conditional systems for RNA interference . Nature Methods, 3 (9), 682–688. PubMed (Link..., L. (2023). A comprehensive review of small interfering RNAs (siRNAs): mechanism, therapeutic targets... -
Arf GTPase Family
TypeCollection... Plasmid Collections ARF Superfamily Plasmids for ARF Superfamily Research You may also like... ...members of the RAS superfamily, though now have been argued to form their own superfamily (Klinger, et al...signaling activity. Figure 1: Locations of ARF superfamily members. Figure from Szutl, et al., 2019. Browse... window) Sztul, E., Chen, P., Casanova, J. E., Cherfils, J., Dacks, J. B., Lambright, D. G., Lee, F. S... -
Antibody Guide
TypeCollection...signaling molecules, as some buffer components can interfere with the conjugate or conjugation process. Sodium...used as an antimicrobial agent. Other chemical interferences with conjugating reactions are possible. It ... antibody to specifically bind to a protein is powerful, but in order to utilize it in the lab, researchers...fluorophores. Horseradish peroxidase (HRP) HRP performs a chemiluminescent reaction in the presence of...activated and its output measured. This method can be performed using the indirect detection method via a conjugated...protein complexes for downstream analysis. They are powerful tools for understanding protein or protein interactions...above. Reverse the crosslink, isolate DNA, and perform downstream analysis. Special considerations One... -
CRISPR Plasmids - Plants
TypeCollection...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a ...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target...pyogenes Bar Chen 50580 pBUN6I11 OsU3 BsaI yes, interfere S. pyogenes Bar Chen 50582 pBUN501 AtU6-26 BsaI...pyogenes Hyg Chen 50587 pHSN6I01 AtU6-26 BsaI yes, interfere S. pyogenes Hyg Chen 50589 pHSN501 AtU6-26 BsaI...