We narrowed to 25,285 results for: crispr
-
Plasmid#157658PurposeCRISPR reporter for mRNA quantification, integrative plasmid into NPR2 geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCAS9-VP64, mCherry, KanMX
UseInsert storage (replicative in e. coli)MutationN28D in mCherry- please see depositor comments be…Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cas9-FCPF
Plasmid#220141PurposeExpresses Cas9-FCPF in mammalian cellsDepositorAvailable sinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIF1079
Plasmid#237445PurposeExpression SpCas9 and Efe1-RT from bidirectional CAG promoters. SpCas9 sgRNA and Efe1 non-coding expression is driven by U6 and H1 respecitvely.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSpCas9
Efe1-RT
EMX1 sgRNA
Efe1-ncRNA targeting EMX1
Tags3xFLAGExpressionMammalianPromoterCAG, H1, and U6Available sinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_TRAC
Plasmid#164993PurposeExpression of gRNA targeting TCRalpha constant locusDepositorInsertgRNA against TRAC
UseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWS5390-CRISPRai-URA3
Plasmid#182829PurposeSaccharomyces cerevisiae inducible CRISPRai vector - URA3 markerDepositorTypeEmpty backboneUseCRISPRAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone1
Plasmid#162125PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-exon1
Plasmid#177261PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dNrg1
Plasmid#173696PurposeA knockout vector for the dog Nrg1.DepositorInsertA gRNA targeting the dog Nrg1 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEreg
Plasmid#173697PurposeA knockout vector for the dog Ereg.DepositorInsertA gRNA targeting the dog Ereg gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dTgfa
Plasmid#173698PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dHbegf
Plasmid#173699PurposeA knockout vector for the dog Hbegf.DepositorInsertA gRNA targeting the dog Hbegf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEgf
Plasmid#173700PurposeA knock-out vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-bleo-dEgf
Plasmid#173840PurposeA knock-out vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-puro-dHbegf
Plasmid#173841PurposeA knockout vector for the dog Hbegf.DepositorInsertA gRNA targeting the dog Hbegf gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-neo-dTgfa
Plasmid#173842PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only