This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Aindrila Mukhopadhyay Lab Plasmids

The Aindrila Mukhopadhyay Lab has deposited plasmids at Addgene for distribution to the research community. Addgene is a nonprofit plasmid repository dedicated to improving life science research.

Learn more about research in the Aindrila Mukhopadhyay Lab.

Addgene Alerts

Receive email alerts when new plasmids from this lab become available.

Log in to subscribe to Addgene Alerts.

Title Authors Publication
Engineering microbial biofuel tolerance and export using efflux pumps. Dunlop MJ, Dossani ZY, Szmidt HL, Chu HC, Lee TS, Keasling JD, Hadi MZ, Mukhopadhyay A Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21.
A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Reider Apel A, d'Espaux L, Wehrs M, Sachs D, Li RA, Tong GJ, Garber M, Nnadi O, Zhuang W, Hillson NJ, Keasling JD, Mukhopadhyay A Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
ID Plasmid Gene/Insert Vector Type Publication Hidden Extra Search Info  
45361pBbA5k-EPL123AcrABBacterial Expression, Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45401pBbA5k-EPL3mexF, Avin_33870 (Synthetic)Bacterial Expression, Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k mexF Avin_33870 Add to Cart
45402pBbA5k-EPL4Avin_44060 (Synthetic)Bacterial Expression, Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45403pBbA5k-EPL11ttgB, PP_1385 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45404pBbA5k-EPL12PP_3456 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45405pBbA5k-EPL14mexF, PP_3426 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45406pBbA5k-EPL15PP_0906 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45408pBbA5k-EPL33PA_2018 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45409pBbA5k-EPL36mexF, PA2494 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45410pBbA5k-EPL37PA_4375 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45411pBbA5k-EPL42PFL_1331 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45412pBbA5k-EPL43PFL_3271 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45413pBbA5k-EPL45PFL_1028 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45414pBbA5k-EPL48PFL_1158 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45415pBbA5k-EPL52Rmet_4866 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45417pBbA5k-EPL54Rmet_1702 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45418pBbA5k-EPL55Maqu_3494 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45419pBbA5k-EPL56Maqu_0582 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45420pBbA5k-EPL59PSPPH_4014 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45421pBbA5k-EPL61PSPPH_2907 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45422pBbA5k-EPL63mdtB, PSPPH_2641 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45423pBbA5k-EPL64PSPPH_0733 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45424pBbA5k-EPL65PSPPH_1196 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45425pBbA5k-EPL66PSPPH_0329Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45427pBbA5k-EPL68Gmet_1664 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45428pBbA5k-EPL69Gmet_2518 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45429pBbA5k-EPL70Gmet_1652 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45431pBbA5k-EPL84BP_2076 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45432pBbA5k-EPL90DVU_0438 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45434pBbA5k-EPL95AcrB/AcrD/AcrFa, ABO_0964 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45436pBbA5k-EPL98acrB, PSHAb_0324 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45437pBbA5k-EPL100Shal_0198 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45438pBbA5k-EPL101Shal_1195 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45439pBbA5k-EPL102Shal_2167 (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45440pBbA5k-EPL122acrF (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
45441pBbA5k-EPL124acrD (Synthetic)Synthetic BiologyEngineering microbial biofuel tolerance and export using efflux pumps. Mol Syst Biol. 2011 May 10;7:487. doi: 10.1038/msb.2011.21. pBbA5k Add to Cart
87382p426_Cas9_gRNA-ARS106aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1. p426 Add to Cart
87383p426_Cas9_gRNA-ARS208aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2. p426 Add to Cart
87384p426_Cas9_gRNA-ARS308aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3 p426 Add to Cart
87385p426_Cas9_gRNA-RDS1aHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3 p426 Add to Cart
87386p426_Cas9_gRNA-ARS416dHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4. p426 Add to Cart
87387p426_Cas9_gRNA-ARS511bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5. p426 Add to Cart
87388p426_Cas9_gRNA-ARS607c Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6. p426 Add to Cart
87389p426_Cas9_gRNA-SAP155bHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6 p426 Add to Cart
87390p426_Cas9_gRNA-SAP155c Human Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6 p426 Add to Cart
87391p426_Cas9_gRNA-CAN1yHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6. p426 Add to Cart
87392p426_Cas9_gRNA-ARS720aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7. p426 Add to Cart
87393p426_Cas9_gRNA-ARS805aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8. p426 Add to Cart
87394p426_Cas9_gRNA-ARS911bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9. p426 Add to Cart
87395p426_Cas9_gRNA-ARS1021bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10. p426 Add to Cart
87396p426_Cas9_gRNA-ARS1014aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10. p426 Add to Cart
87397p426_Cas9_gRNA-ARS1114aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11. p426 Add to Cart
87398p426_Cas9_gRNA-ARS1206aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12. p426 Add to Cart
87399p426_Cas9_gRNA-ARS1309aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13. p426 Add to Cart
87400p426_Cas9_gRNA-ARS1414aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14. p426 Add to Cart
87401p426_Cas9_gRNA-YOLCd1bHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15. p426 Add to Cart
87402p426_Cas9_gRNA-HIS3bHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15. p426 Add to Cart
87403p426_Cas9_gRNA-ARS1622bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16. p426 Add to Cart
87404p426_Cas9_gRNA-YPRCd15cHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14. p426 Add to Cart
87405p426_Cas9_gRNA-R-RDS1aHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. p426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3. p426 Add to Cart
87407p425_Cas9_gRNA_LEU_1014aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. p425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10. p425 Add to Cart
87408p426_Cas9_gRNA-R-ARS805aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8. p426 Add to Cart
87409p426_Cas9_gRNA-R-ARS607cHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c (Saccharomyces cerevisiae)CRISPRA Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6. p426 Add to Cart