We narrowed to 10,117 results for: transfer
-
Plasmid#235148PurposeExpresses the mCherry-based mutated (control) sensor for miR-124. TagBFP2 is expressed as a transduction reporterDepositorInsertmCherry with a mutated miR-124 MRE
UseAAVMutation7 nucleotides of the miR-124 WT MRE mutatedPromoterEFSAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-L7-6-FLAG-HA-T6B-MUT-YFP
Plasmid#235142PurposeExpresses the mutant T6B peptide fused with YFP under the Purkinje cell-specific L7-6 promoterDepositorInsertmutant T6B peptide
UseAAVTagsFLAG/HAMutation5 tryptophan residues of T6B-WT mutatedPromoterL7-6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV PHP.eB-CAG-Venus
Plasmid#233695PurposeAAV expression of Venus from CAG promoterDepositorInsertVenus
UseAAVExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minBG-EGFP-W3SL_BbsI(GGA)
Plasmid#231362PurposeminBG-driven EGFP, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231363PurposePle155-driven EGFP, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-HA-mCherry-pA
Plasmid#233028PurposeTo Express HA tagged CasRX-mCherry fusion protein from the mammalian EFS promoterDepositorInsertCasRx-mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV pSYN eGFP T2A SP HALO HAPLN1
Plasmid#228199PurposeAAV vector expressing GFP and HaloTag-HAPLN1 under synaptophysin promoterDepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mtPyronicSF
Plasmid#228906PurposeExpression of mtPyronicSF in neurons targeted to the mitochondria serving as an optical sensor for mitochondrial pyruvate uptake. Backbone from Addgene plasmid 100834DepositorInsertpyronic SF
UseAAVTagsCox8 targettingExpressionMammalianPromoterCamKIIAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Nme2-U6-sgRNA scaffold
Plasmid#226933PurposeEncoding Nme2ABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nNme2Cas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-SaKKH-U6-sgRNA scaffold
Plasmid#226935PurposeEncoding SaKKHABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSaKKHCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-Sun1-GFP-WPRE-BC12-pA
Plasmid#220764PurposeExpression of Sun1GFP for nuclei isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertSun1-GFP-WPRE-BC12
UseAAVPromoterCAGAvailable SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hGRN2
Plasmid#213683PurposeExpresses human granulin-2 with an N-terminal twin-Strep-FLAG tagDepositorInserthuman Granulin-2
UseAAVTagstwin-Strep-FLAGPromotercytomegalovirus enhancer/chicken β-actin promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF149 shRNA-TRE
Plasmid#225337PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertRNF149 shRNA (Rnf149 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
USP7 shRNA-TRE
Plasmid#225338PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertUSP7 shRNA (Usp7 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Luciferase shRNA-TRE
Plasmid#225339PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertLuciferase shRNA (LOC116160065 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1301-AAV-EFSNC-dCjCas9-NIPP1(143-224)
Plasmid#223146PurposeExpression of truncated NIPP1 with dCjCas9 and empty gRNA scaffoldDepositorInsertNIPP1 (PPP1R8 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 143-224PromoterEF1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1311-AAV-EFSNC-dSaCas9-NIPP1(143-224)
Plasmid#223156PurposeExpression of truncated NIPP1 with dSaCas9 and empty gRNA scaffoldDepositorInsertNIPP1 (PPP1R8 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 143-224PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-Sun1-GFP-WPRE-BC8-pA
Plasmid#220760PurposeExpression of Sun1GFP for nuclei isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertSun1-GFP-WPRE-BC8
UseAAVPromoterCAGAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-Sun1-GFP-WPRE-BC10-pA
Plasmid#220762PurposeExpression of Sun1GFP for nuclei isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertSun1-GFP-WPRE-BC10
UseAAVPromoterCAGAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-Sun1-GFP-WPRE-BC9-pA
Plasmid#220761PurposeExpression of Sun1GFP for nuclei isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertSun1-GFP-WPRE-BC9
UseAAVPromoterCAGAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-Sun1-GFP-WPRE-BC11-pA
Plasmid#220763PurposeExpression of Sun1GFP for nuclei isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertSun1-GFP-WPRE-BC11
UseAAVPromoterCAGAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Seq17_VS33_4.26_ChimeraIntron_3NLS_RFP_WPRE_polyA
Plasmid#220225PurposeAAV-STARR-seq validation vector containing VS33 enhancerDepositorInsertEnhancer (VS33)
UseAAVExpressionMammalianPromoterCMVAvailable SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hIsl2-EGFP
Plasmid#153206PurposeHuman Isl2 (hIsl2) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-Sun1-GFP-WPRE-BC7-pA
Plasmid#220759PurposeExpression of Sun1GFP for nuclei isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertSun1-GFP-WPRE-BC7
UseAAVPromoterCAGAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
NL1
Plasmid#218404PurposeNL1 insert in AAV9 capsidDepositorInsertNL1 7mer (LTTEGRR)
UseAAVAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1
Plasmid#218405PurposeTH1 insert in AAV9 capsidDepositorInsertTH1 7mer (HPARALP)
UseAAVAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-APOBEC1-YTHmut-EGFP
Plasmid#209323PurposeAAV packaging vector containing a APOBEC1-YTHmut expression cassette, a P2A-EGFP expression cassette.DepositorInsertAPOBEC1--YTHmut-HA
UseAAVTagsHAMutationYTH domain lacks AA 385-409 comprising the m6A-bi…Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EGFP-APOBEC1-YTHmut
Plasmid#209320PurposeAAV packaging vector containing a EGFP-P2A expression cassette, APOBEC1-YTHmut cassette.DepositorInsertAPOBEC1-YTHmut-HA
UseAAVTagsHAMutationYTH domain lacks AA 385-409 comprising the m6A-bi…Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only