We narrowed to 3,228 results for: Streptococcus
-
Plasmid#103083PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertA8LN05(Cas9 coding gene from Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B1UZL4
Plasmid#103085PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB1UZL4(Cas9 coding gene from Clostridium perfringens D str. JGS1721)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-B8I085
Plasmid#103089PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertB8I085(Cas9 coding gene from Clostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA4
Plasmid#100556PurposeExpresses MYC sgRNA4. Target sequence: GTAATTCCAGCGAGAGGCAGDepositorInsertMYC sgRNA4
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
EMX1_sgRNA
Plasmid#100555PurposeExpresses EMX1 sgRNA. Target sequence: GAGTCCGAGCAGAAGAAGAADepositorInsertEMX1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_3_TOPO_TA-ms2-VP64
Plasmid#79371PurposeRecruits VP64 to a compatible gRNA for transcriptional activationDepositorInsertMS2-VP64
UseCRISPRExpressionMammalianAvailable SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ915v2+Nterm Spe1 +Cterm Age1 site
Plasmid#88914PurposeFor expression of modified SpyCas9 in e.coli.DepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAct:MCP-VP64
Plasmid#78904PurposeExpresses MCP:VP64 under actin promoter for "Scaffold" CRISPRa in Drosophila cellsDepositorInsertMS2:VP64
UseCRISPRExpressionInsectPromoterpActin (Drosophila)Available SinceMarch 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICSL80037
Plasmid#68260PurposeLevel 0 Golden Gate Part: Coding sequence, neomycin phophotransferase II (Escherichia coli)DepositorInsertCoding sequence, neomycin phophotransferase II (Escherichia coli)
UseSynthetic BiologyAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pICSL11061
Plasmid#68255PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting BolC.GA4a-1 in Brassica oleraceaDepositorInsertPromoter_AtU6-26 + sgRNA_BolC.GA4a-1
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pICSL11058
Plasmid#68254PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting PM19_3 in barleyDepositorInsertPromoter_TaU6 + sgRNA_HvPM19_3
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
APq5210
Plasmid#66086Purposeco-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORFDepositorInsertsgRNA for APa4-2
UseCRISPRExpressionWormPromoterU6Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -296
Plasmid#50926PurposeU6 driven sgRNA targeting Sox17 -296 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -91
Plasmid#50923PurposeU6 driven sgRNA targeting Sox17 -91 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTBL3440 MTK_PBdest lacO-hU6-BtoApegRNA-LacI-mCherry
Plasmid#254862PurposepeCHYRON destination vector expressing IPTG-inducible B-to-A pegRNA, LacI, and mCherry. Can be integrated into the genome of mammalian cells with PiggyBac transposase.DepositorInsertslacO_hU6_promoter-peCHYRON_BtoA_pegRNA
pCAG-LacI-rb_glob_polyA
pEF1alpha-mCherry-BGH_polyA
UsePiggybac integrationExpressionMammalianAvailable SinceJune 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTBL3439 MTK_PBdest lacO-hU6-AtoBpegRNA-LacI-mCherry
Plasmid#254861PurposepeCHYRON destination vector expressing IPTG-inducible A-to-B pegRNA, LacI, and mCherry. Can be integrated into the genome of mammalian cells with PiggyBac transposase.DepositorInsertslacO_hU6_promoter-peCHYRON_AtoB_pegRNA
pCAG-LacI-rb_glob_polyA
pEF1alpha-mCherry-BGH_polyA
UsePiggybac integrationExpressionMammalianAvailable SinceJune 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
Donor idCas9-VP64-Blast
Plasmid#255021PurposeDonor plasmid targeting the AAVS1 human locus to express dCas9-VP64 upon dox inductionDepositorInsertdCas9-VP64
Tags3x FLAGExpressionMammalianPromoterTight TREAvailable SinceMay 20, 2026AvailabilityAcademic Institutions and Nonprofits only