We narrowed to 52,364 results for: RON
-
Plasmid#71719PurposeExpressing a GFP-tagged degron in the soma of C. elegansDepositorInsertauxin-responsive protein IAA17 (AXR3 Mustard Weed)
TagsEmGFPExpressionWormMutationminimal degron sequence (71-114aa) with start cod…Promotereef-1A.1 (eft-3)Available SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-EDA in pMAX
Plasmid#120402Purposeenables eukaryotic expression of human EDA (or EIIIA) containing fibronectin based on plasma fibronectin sequenceDepositorAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOpen-lambda red operon
Plasmid#165521PurposeOperon containing Exo, Bet, and Gam. To use the lambda red recombineering system to modify your target DNA.DepositorInsertlambda red operon
UseSynthetic BiologyAvailable SinceAug. 3, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
PyronicSF-mRuby2/pBI-CMV1
Plasmid#124830PurposeHighly resposive GFP-based pyruvate nanosensor.DepositorInsertsPyronicSF
mRuby2
ExpressionMammalianPromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Chronos(M140T)-mRuby2-ST
Plasmid#109129PurposeModified cation channelrhodopsin Chronos fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorInsertChronos(M140T)-mRuby2-ST
ExpressionMammalianPromoterCAGAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-nsp3-c3xFLAG
Plasmid#215696PurposeProduces the Chikungunya virus nonstructural protein 3 with a c-terminal 3xFLAG tagDepositorInsertCHIKV nsp3
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CaMKII-Chronos-GFP
Plasmid#58805PurposeAAV expression of Chronos-GFP under the CaMKII promoterDepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-EDB in pMAX
Plasmid#120403Purposeenables eukaryotic expression of human EDB (or EIIIB) containing fibronectin based on plasma fibronectin sequenceDepositorAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-EGFP-Donor
Plasmid#159740PurposeContains EGFP flanked by a splice acceptor and a splice donor. Together with other intron tagging plasmids, it can be used to place the EGFP tag as a synthetic exon into introns of target genes.DepositorInsertEGFP
UseIntron tagging donorAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
PCMV-intron myc Rab2WT
Plasmid#46779Purposeexpression of WT Rab2a in mammalian cellsDepositorAvailable SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2259 - Intron GG2 - 900 bp
Plasmid#159881PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG2 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2215 - Intron GG3 - 900 bp
Plasmid#159882PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG3 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2214 - Intron GG1 - 900 bp
Plasmid#159880PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG1 - 900 bp
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-Voltron
Plasmid#119035PurposeCre-dependant expression of Voltron in neuronsDepositorInsertVoltron
UseAAVExpressionMammalianPromoterhsynAvailable SinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV Puro DEST P38KTRDronpa
Plasmid#205763PurposeExpression of P38 KTR Dronpa under CMV promoter (With Puromycin Resistance)DepositorInsertP38 KTR Dronpa
UseLentiviralExpressionMammalianMutationwtAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-no_intron
Plasmid#127597Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoterDepositorInsert1xFLAG-MCP expression cassette
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-Positron-ST
Plasmid#129267PurposeCre-dependant expression of soma-localized Positron in neuronsDepositorInsertPositron-ST
UseAAVExpressionMammalianMutationD92N, E199VPromoterhsynAvailable SinceOct. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-Structural polyprotein
Plasmid#215698PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-E2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-E2-6K-E1
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits