We narrowed to 17,900 results for: Jun;
-
Plasmid#226479PurposepMOLC360_VR_I4 (Chloramphenicol R) containing the insert I4 to be assembled in POC1518 (pMOBK360_VL) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1539
Plasmid#226480PurposepMOLC360_VL_I5 (Chloramphenicol R) containing the insert I5 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1540
Plasmid#226481PurposepMOLC360_VM_I6 (Chloramphenicol R) containing the insert I6 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1541
Plasmid#226482PurposepMOLC360_VR_I7 (Chloramphenicol R) containing the insert I7 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1542
Plasmid#226483PurposepMOLC360_VL_I8 (Chloramphenicol R) containing the insert I8 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1543
Plasmid#226484PurposepMOLC360_VR_I9 (Chloramphenicol R) containing the insert I9 to be assembled in POC1519 (pMOBK360_VM) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1544
Plasmid#226485PurposepMOLC360_VL_I10 (Chloramphenicol R) containing the insert I10 to be assembled in POC1520 (pMOBK360_VR) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1545
Plasmid#226486PurposepMOLC360_VR_I11 (Chloramphenicol R) containing the insert I11 to be assembled in POC1520 (pMOBK360_VR) using the site-selective methylation protectionDepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1426
Plasmid#221573PurposePlasmid containing the Insert 1 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1427
Plasmid#221574PurposePlasmid containing the Insert 2 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1428
Plasmid#221575PurposePlasmid containing the Insert 3 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1429
Plasmid#221576PurposePlasmid containing the Insert 4 to be assembled in POC1430 using the site-selective methylation protection approachDepositorInsertDNA fragment flanked by methylation-protectable BsaI sites and containing one always-methylable internal BsaI site
UseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB027
Plasmid#234636PurposepET-28a(+) based plasmid for expression of H16_B1102 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB028
Plasmid#234637PurposepET-28a(+) based plasmid for expression of H16_B1148 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB029
Plasmid#234638PurposepET-28a(+) based plasmid for expression of H16_B1264 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB030
Plasmid#234639PurposepET-28a(+) based plasmid for expression of H16_B1335 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLB026
Plasmid#234635PurposepET-28a(+) based plasmid for expression of H16_A3514 from Cupriavidus necator H16, with N-terminal hexahistidine tagDepositorAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only