We narrowed to 7,982 results for: Gateway entry
-
Plasmid#123076PurposeGateway entry clone encoding human MAP1LC3B2 G120ADepositorInsertMicrotubule-associated proteins 1A/1B light chain 3 beta 2 (MAP1LC3B2 Human)
UseGateway entry vector / entry cloneMutationGlycine 120 to AlanineAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-CTSL
Plasmid#158444PurposeGateway Cloning compatible entry vector for the human CTSL gene.DepositorInsertCTSL (CTSL Human)
UseGateway entry vectorAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
9336-E07
Plasmid#234302PurposeGateway ORF Entry clone of human TGFBR1 NDN to A with stop codon (for native or N-terminal fusions)DepositorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
8522-E08
Plasmid#234293PurposeGateway ORF Entry clone of mouse Tgfbr1 with stop codon (for native or N-terminal fusions); N/267A/D269A/N270A mutationsDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E05
Plasmid#234300PurposeGateway ORF Entry clone of human Tgfbr1 with stop codon (for native or N-terminal fusions); T204D mutationDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E06
Plasmid#234301PurposeGateway ORF Entry clone of human TGFBR1 with stop codon (for native or N-terminal fusions); K232R mutationDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pDONR221-hspa13
Plasmid#192730PurposeGateway entry vector encoding zebrafish hspa13DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-dyrk1aa
Plasmid#192741PurposeGateway entry vector encoding zebrafish dyrk1aaDepositorAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only