We narrowed to 8,309 results for: 11
-
Plasmid#113350Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of PVT1 geneDepositorInsertPVT1-enhancer (PVT1 Human)
UseLuciferaseAvailable sinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSICO-CPSF6-358-iRFP670
Plasmid#110694PurposeExpresses a truncated form of CPSF6 (CPSF6-358 originally described in Lee et al. Cell Host Microbe 2010) fused with iRFP670DepositorInsertCPSF6-iRFP670 (CPSF6 Human)
UseLentiviralTagsiRFP670MutationTruncation of CPSF6 isoform at amino acid 358Available sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pONSY-CoNMM:mCherry
Plasmid#111878PurposeThis plasmid expresses mCherry fluorescent protein fused to an N-Myristoylation motif (NMM) from the endogenous Src2 gene (CAOG_06360). It can be used to visualize the membrane and filopodia.DepositorInsertCapsaspora N-Myristoylation motif (CoNMM) from the Src2 gene fused to mCherry
UseCapsaspora owczarzakiTagsmCherryPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHAGE2-EF1alpha-HA-TFAP4
Plasmid#110158PurposeLentiviral vector for expression of human TFAP4 in mammalian cellsDepositorInsertTFAP4 (transcription factor AP-4) (TFAP4 Human)
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
3XFlag-pLPC
Plasmid#73560Purposevector encoding 3 Flag tagsDepositorInsert3X-Flag
UseRetroviralTags3X-FLAGExpressionMammalianPromoterCMVAvailable sinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pReporter_9
Plasmid#60569PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_9
ExpressionBacterialPromoterBBa_J23119Available sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
UASGAL-Pgal
Plasmid#60338PurposeContains a promoter of activating sequence derived from native galactose promoter coupled with full length native galactose promoterDepositorInsertpromoter
UseSynthetic Biology; Yeast synthetic hybrid promote…ExpressionYeastAvailable sinceNov. 6, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
UASGAL-PCYC
Plasmid#60335PurposeContains a promoter of activating sequence derived from native galactose promoter coupled with a core promoter derived from native Leucine promoter.DepositorInsertpromoter
UseSynthetic Biology; Yeast synthetic hybrid promote…ExpressionYeastAvailable sinceNov. 6, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p413GAL1-Zipp.-L-IFP-F[2] (Yeast)
Plasmid#52893PurposePlasmid+insert encoding GCN4-leucine zipper fused to IFP-F[2] by the linker (GGGGS) X 2. Zipper-L-IFP-F[2] (XbaI/XhoI). Zipper is (XbaI /ClaI). Plasmid confers ampicillin resistance to DH5α.DepositorInsertZipp.-L-IFP-F[2]
TagsL-IFP-F[2]ExpressionYeastPromoterGAL1Available sinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-C-TEV-Twin-Strep
Plasmid#202527PurposeExpress N-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged protein (ENLYFQGS-WSHPQFEK-(GGGS)2-GGSA-WSHPQFEK) in mammalian cellDepositorTypeEmpty backboneTagsTEV cleavable site and Twin-Strep-tagExpressionMammalianPromoterCAGAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-41
Plasmid#172757PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-41; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-41
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available sinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-YdLight1
Plasmid#125705PurposeExpresses the yellow genetically encoded dopamine sensor YdLight1 in mammalian cells.DepositorInsertYdLight1
TagsFlag tagExpressionMammalianPromoterCMVAvailable sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable sinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AausFP2
Plasmid#129500PurposeExpresses AausFP2 constitutively in E. coli (most strains)DepositorInsertAausFP2
ExpressionBacterialPromotersynthetic constitutive (stationary phase) promote…Available sinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK2_023
Plasmid#123715PurposeEncodes pCMV as a Type 2 part to be used in the MTK systemDepositorInsertpCMV
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSuper.Retro.Puro-WDR5 shRNA 2
Plasmid#59975PurposeKnockdown of WDR5DepositorInsertWDR5 shRNA
UseRetroviralAvailable sinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNHA7
Plasmid#223649PurposebirA protein purificationDepositorInsertBioID_G118R
Tags6HisExpressionBacterialMutationG118RPromoterLacIAvailable sinceOct. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-C1-BBS5
Plasmid#218714PurposeExpresses N-terminally EGFP-tagged BBS5 in mammalian cellsDepositorAvailable sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS4
Plasmid#218713PurposeExpresses N-terminally EGFP-tagged BBS4 in mammalian cellsDepositorAvailable sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpH-HsNot9_S
Plasmid#147494PurposeBacterial Expression of HsNot9DepositorInsertHsNot9 (CNOT9 Human)
ExpressionBacterialAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only