We narrowed to 12,388 results for: shRNA
-
Plasmid#245953PurposeExpression of inactive (phosphomimetic) cofilin S3E resistant to shRNA in cells coexpressing mRFPDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationS3E + silent mutations (NTs 67 to 75) in which TC…PromoterCMV for huCof S3E and separate CMV for mRFPAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof S3A SSR RedTrack
Plasmid#245956PurposeExpression of constitutively active cofilin S3A resistant to shRNA in cells coexpressing mRFPDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationS3A + silent mutations (NTs 67 to 75) in which TC…PromoterCMV for huCof S3A and separate CMV for mRFPAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.3QS
Plasmid#235485Purposeinducible NOT gate receiver with bs for sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.6
Plasmid#235471PurposeMessage phagemid carrying sgRNA6 (prom. J23110, backbone pBR322)DepositorInsertsgRNA6
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK052.3
Plasmid#235472PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone RSF1030)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK001.23
Plasmid#235484Purposedual NOT gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.1
Plasmid#235460PurposeMessage phagemid carrying sgRNA1 (prom. J23119, backbone pBR322)DepositorInsertsgRNA1
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.3
Plasmid#235462PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone pBR322)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.4
Plasmid#235463PurposeMessage phagemid carrying sgRNA4 (prom. J23119, backbone pBR322)DepositorInsertsgRNA4
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.5
Plasmid#235464PurposeMessage phagemid carrying sgRNA5 (prom. J23119, backbone pBR322)DepositorInsertsgRNA5
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.6
Plasmid#235465PurposeMessage phagemid carrying sgRNA6 (prom. J23119, backbone pBR322)DepositorInsertsgRNA6
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.1
Plasmid#235466PurposeMessage phagemid carrying sgRNA1 (prom. J23110, backbone pBR322)DepositorInsertsgRNA1
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.2
Plasmid#235467PurposeMessage phagemid carrying sgRNA2 (prom. J23110, backbone pBR322)DepositorInsertsgRNA2
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.3
Plasmid#235468PurposeMessage phagemid carrying sgRNA3 (prom. J23110, backbone pBR322)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.4
Plasmid#235469PurposeMessage phagemid carrying sgRNA4 (prom. J23110, backbone pBR322)DepositorInsertsgRNA4
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.5
Plasmid#235470PurposeMessage phagemid carrying sgRNA5 (prom. J23110, backbone pBR322)DepositorInsertsgRNA5
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJ105
Plasmid#208859PurposeExpresses SoxS activation domain and gRNA targeting 105 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 105
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuperior.retro.neo GFP shScramble
Plasmid#220357PurposeRetroviral expression vector for an shScrambleDepositorInsertshScramble
UseRNAi and RetroviralPromoterH1Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only