We narrowed to 8,893 results for: aav
-
Plasmid#248781PurposeAAV construct expressing eGFP-KASH enabling FACS-sorting of extracted nucleiDepositorInserteGFP-KASH
PromoterCbhAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-HA-mTFEB
Plasmid#243758PurposeAAV plasmid expressing HA-tagged codon-optimized mouse TFEB under the CAG promoter.DepositorAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tbg-CES2A-ΔC
Plasmid#200558PurposeSecreted mouse CES2A driven by heptaocyte-specific promoter in AAV viral vectorDepositorInsertMouse Carboxylesterase 2A delta C-terminal (Ces2a Mouse)
UseAAVTagsFlagPromoterTBG promoterAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS-shCHD5 #2
Plasmid#68877PurposeCHD5 shRNA expressed from Adeno-associated viral (AAV) vectorDepositorInsertCHD5
UseAAV and RNAiExpressionMammalianPromoterH1Available SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390) (AAV PHP.eB)
Viral Prep#163505-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390) (#163505). In addition to the viral particles, you will also receive purified AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390) plasmid DNA. AAV vector for strong and rapid SYFP2 expression in forebrain GABAergic interneurons. The enhancer core sequence has 100% sequence conservation between mouse and human. Developed especially for rapid viral labeling in human and NHP organotypic brain slice culture. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterminBetaGlobinTagsSYFP2Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP11279 - pAAV-eHGT_022m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1279)
Plasmid#163507PurposeDirect-expressing SYFP2 AAV VirusDepositorInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sasgRNACMV- mCherry-WPREpA
Plasmid#217015PurposeS. aureus sgRNAs backbone along with mCherry expressionDepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CamKIIa-ChR2-EGFP
Plasmid#114216PurposeExpresses channelrhodopsin-EGFP fusion in CamKIIa+ neuronsDepositorInsertChannelrhodopsin 2
UseAAV and Mouse TargetingTagsEGFPExpressionMammalianPromoterCamKIIa 1.3 kbAvailable SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-Lrat
Plasmid#206345PurposeAAV plasmid expressing LRAT in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 bPAC cMyc S27A 2A tDimer
Plasmid#85398Purposehumanized photoactivated adenylyl cyclase lower dark activity, spectrum shifted 15 nm longer wavelenght with neuron-specific promoter, plus red fluorescent proteinDepositorInsertshumanized photoactivated adenylyl cyclase
red fluorescent protein
UseAAVTagscMyc TagExpressionMammalianMutationS27APromoterhuman Synapsin1 promotor and ribosomal skip seque…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-IE94-Flex-TM-KA2-Cam-NES-TeVN-AsLOV2-TEVseq-bGH-PA
Plasmid#171619PurposeAAV floxed Soma-targeted Cal-Light with KA2DepositorInsertIE94-Flex-TM-KA2-Cam-NES-TeVN-AsLOV2-TEVseq-bGH-PA
UseAAV, Cre/Lox, Mouse Targeting, and Synthetic Biol…ExpressionMammalianPromoterCMVAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfABC1D-NLS-GFP-WPRE-synpA-L1-R2
Plasmid#203541PurposegRNA expression in astrocytesDepositorInsertNLS-GFP, 2x U6-RNA
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-TurboID
Plasmid#237885PurposeAAV vector for Cre-dependent expression of TurboIDDepositorInsertTurboID
UseAAV and Cre/LoxTagsFLAG tagExpressionMammalianPromoterCAGAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX-H2BmTagBFP2-oG
Plasmid#217976PurposeAAV transfer plasmid to express H2B-BFP and codon-optimized Rabies G proteinDepositorInsertsH2BmTagBFP2
oG
UseAAVTagsmTAGBFP2PromoterhSynAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-YPet-WPRE
Plasmid#193342PurposeAAV-mediated expression of YPet under the TRE promoter in mammalian cellsDepositorInsertYPet
UseAAVExpressionMammalianPromoterTREAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-mNeonGreen-WPRE
Plasmid#193341PurposeAAV-mediated expression of mNeonGreen under the TRE promoter in mammalian cellsDepositorInsertmNeonGreen
UseAAVExpressionMammalianPromoterTREAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ef1a-DIO-eGCaMP(2+)
Plasmid#201150PurposeAAV virus production for Cre recombinase dependent expression of eGCaMP(2+)DepositorInserteGCaMP_2+
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianAvailable SinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfaABC1D-DreO-4x6T
Plasmid#196413PurposeAstrocytic expression of Dre recombinase in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassetteDepositorInsertDreO
UseAAV; Astrocyte-selectiveExpressionMammalianPromoterCAG and GfaABC1DAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-RiboL1-jGCaMP7c
Plasmid#192619PurposeAAV transfer plasmid for neuronal expression of soma-targeted (RiboL1) jGCaMP7c.DepositorInsertRiboL1-jGCaMP7c
UseAAVTags6xHisExpressionMammalianAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only