We narrowed to 41,116 results for: gats
-
Plasmid#229829PurposeA gateway compatible 5' entry clone containing an MCS upstream of the murine c-fos minimal promotor and b-globin intron.DepositorInsertc-fos minimal promoter and b-globin intron
UseGateway entry cloneTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-hApg5(K130R)-HA
Plasmid#22949DepositorInsertHomo sapiens ATG5 autophagy related 5 homolog (S. cerevisiae) (ATG5 Human)
UseTags3xHAExpressionMammalianMutation130 Lysine to ArgininePromoterAvailable sinceJune 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-GABARAPL2 G116A
Plasmid#123104PurposeExpresses 3xFLAG-GABARAPL2 G116A in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 2 (GABARAPL2 Human)
UseTags3xFLAGExpressionMammalianMutationGlycine 116 to AlaninePromoterCMVAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mKate2
Plasmid#162624PurposeAllows for transcription of mKate2 control for injection into zebrafish embryos for BiFC assaysDepositorInsertmKate2
UseTagsExpressionMammalianMutationPromoterSP6Available sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3E-CDC42-DN
Plasmid#109584PurposeMultisite gateway vector for 3' tagging with dominant negative CDC42DepositorInsertCDC42 (cdc42 Zebrafish)
UseZebrafish plasmidsTagsExpressionMutationdominant negativePromoterAvailable sinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR-attL5-CRY2-mCh-attL2
Plasmid#160438PurposeEntry vector for cloning Cryptochrome2-mCherry using 2-fragment gateway recombinationDepositorInsertCryptochrome 2 (CRY2 Mustard Weed)
UseTagsmCherryExpressionBacterialMutationPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 PEX14-VAC8-RFP
Plasmid#166844PurposeExpresses Peroxisome localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 390 base pairs from the PEX14 ORFDepositorUseTagsPEX14 transmembrane domain and RFPExpressionYeastMutationPEX14 transmembrane domainPromoterVAC8 promoterAvailable sinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-RFP
Plasmid#166843PurposeExpresses ER localized Vac8-RFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorUseTagsRFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable sinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
[pSK483] pLJC5 Flag-Depdc5(P)
Plasmid#109342PurposeLenti-viral expression of Flag-tagged Depdc5 mutant PDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsFLAGExpressionMutationYDLLP(775-779)GSGSGPromoterAvailable sinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
[pSK496] pLJC5 HA-Depdc5(AB)
Plasmid#109346PurposeLenti-viral expression of HA-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsHAExpressionMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGPromoterAvailable sinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
[pSK497] pLJC5 Flag-Depdc5(AB)
Plasmid#109341PurposeLenti-viral expression of Flag-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsFLAGExpressionMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGPromoterAvailable sinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
Kv7.4 (1-645, Δ368-523)/pcDNA3.1
Plasmid#111456PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
UseTagsExpressionMammalianMutationKv7.4 (1-645, Δ368-523), C643APromoterAvailable sinceMay 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-HKU1-Hemagglutinin-esterase
Plasmid#168902PurposeGateway-compatible Entry vectorDepositorInsertHCoV-HKU1-Hemagglutinin-esterase (HE )
UseGateway-compatible entry vectorTagsExpressionMutationCodon optimized (H.sapiens)PromoterAvailable sinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-Dll4-F2-E1B-B-Globin (JDW 1366)
Plasmid#229843PurposeA gateway compatible 5' entry clone containing the murine Dll4 F2 arterial specific enhancer upstream of a minimal E1b promoter and intron for arterial and endocardial expression.DepositorInsertDll4-F2 (exon3)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-EFS (EF1a core) (JDW 1319)
Plasmid#224474PurposeGateway compatible 5' entry clone with human alpha 2 globin pause site (to prevent transcription readthrough) and EF1a core promoter. Lacks downstream intron for a lower-activity, compact promoter.DepositorInsertEFS promoter
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only