We narrowed to 7,649 results for: Pol
-
Plasmid#121799PurposepMVP L3-L2 entry plasmid, contains polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds CMV-driven GFP-P2A-TETa downstream of gene of interest.DepositorInsertpolyA + CMV::eGFP-P2A-TETa-polyA
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-RPA194
Plasmid#247352PurposeExpresses SpCas9 and a sgRNA targeting the human RPA194 loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATP5F1B-turboGFP
Plasmid#239795PurposeExpresses human ATP5F1B tagged with turboGFPDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV GAG
Plasmid#234992PurposeFor production of Viral like particles (VLPs) by expressing the MLV GAG protein in mammalian cellsDepositorInsertGAG
ExpressionMammalianMutationDeleted polymerase coding sequenceAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Ace-mNeon2-Kv2.1PR
Plasmid#195528PurposeGreen fluorescent, negative response-polarity voltage indicator under the control of CaMKII promoter; soma-targetedDepositorInsertAce-mNeon2-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 81S; SY linkerPromoterCaMKIIAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk12_Untagged
Plasmid#127176PurposeUntagged mouse Cdk12 transgene (NM_001109626.1 isoform) cloned into Gateway entry vectorDepositorInsertMouse Cyclin Dependent Kinase 12 (Cdk12 Mouse)
UseEntry vector with transgene for gateway cloningTagsNonePromoterNoneAvailable SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOCC305
Plasmid#118898Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for rec. protein with N-terminal TwinStrep-MBP tag, cleavable with 3C and C-terminal HIS6, cleavable with 3CDepositorInsertNcoI-TwinStrep-MBP-3C-NotI-ccdB-AscI-3C-HIS6-stop-HindIII cassette
TagsHIS6, cleavable with 3C protease and TwinStrep-MB…ExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
B108-Otx2-IRES-Cre
Plasmid#73993PurposeB108 enhancer of Blimp1 gene drives Otx2 (isoform b) and Cre expression.DepositorInsertB108-Otx2 (isoform b)-IRES-Cre (Otx2 Mouse)
ExpressionMammalianAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB120
Plasmid#68574PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
dishevelled
Plasmid#38342DepositorInsertdishevelled (dsh Fly)
ExpressionBacterialAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV5 MYC-Smurf2 (FF29/30A, Y459A) WT
Plasmid#24606DepositorAvailable SinceMay 5, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFastBac1 Flag Su(Z)2
Plasmid#20202DepositorAvailable SinceFeb. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
GPD 25QDProGFP p416
Plasmid#15568DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGM234
Plasmid#220177PurposeExpresses exogenous wild-type NAC complex members (NACA and BTF3)DepositorAvailable SinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-NQO1
Plasmid#177140PurposeBacterial vector for expression of an N-terminal GST fusion of NQO1 with a TEV protease site located between the GST tag and NQO1DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBa.Kif1a-GFP
Plasmid#162722PurposeMammalian expression of WT mouse Kif1aDepositorInsertKif 1A (Kif1a Mouse)
TagsGFP (E5G)ExpressionMammalianMutationS33N, D528NPromoterChicken Beta actinAvailable SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-HIS-TagGFP2-TEV-GGG-ELP(40nm)-Cys
Plasmid#90474PurposeElastin Like Polypeptide: [(VPGEG)-(VPGVG)4-(VPGAG)2-(VPGGG)2-(VPGEG)]2, with N-Terminal TagGFP2 and TEV-cleavage site, leaving an N-terminal Sortase Recognition Sequence GGG and a C-terminal CysteineDepositorInsertTagGFP2-TEV-GGG-ELP(40nm)-Cys
TagsCysteine and Sortase-TagExpressionBacterialPromoterT7Available SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-OSF-TRIM5alpha(human)
Plasmid#79034PurposeBaculoviral entry vector to produce Bac-to-bac baculovirusesDepositorAvailable SinceMarch 3, 2017AvailabilityAcademic Institutions and Nonprofits only