We narrowed to 10,204 results for: FIE
-
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TRE3G-UCP1
Plasmid#234979PurposeExpresses UCP1 in mouse cell linesDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-hDLXI56i-minBG-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231360PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with hDLXI56i enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-mscRE4-minBG-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231361PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from the minBG promoter with mscRE4 enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minBG-EGFP-W3SL_BbsI(GGA)
Plasmid#231362PurposeminBG-driven EGFP, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231363PurposePle155-driven EGFP, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231367PurposePle155-driven EGFP, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-mRuby2-W3SL_BbsI(GGA)
Plasmid#231368PurposePle155-driven mRuby2, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertmRuby2
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-Ple155-CI-EGFP-W3SL-BC(p1-10)
Plasmid#231351PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses EGFP from Ple155 element, active in Purkinje cells.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-NLS-EGFP-WPRE-SV40pA-T7-T3-BC(p1-14)
Plasmid#231345PurposeSingle stranded AAV genome with components for tracking AAV genome via AAV-Zombie. Also expresses a nuclear localized EGFP from CAG promoter.DepositorInsertT7/T3-BC(p1-14)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only