-
Plasmid#219565Purpose3` circularization cassette to induce Cre-mediated circularization of a genomic region flanked by loxP sites with H2B-GFP reconstitution and mScarlet expression from the chromosomeDepositorInsertHygroR_2A_H2B-GFP-N_loxP_mScarlet
UseUnspecifiedTagsExpressionMutationPromoterEF-1aAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX2-tTA2-WPRE-bGHpA
Plasmid#65458PurposeCan be used to generate AAV virus that will express the tetracycline transactivator tTA2 from the CAG promoter in a Cre-dependent mannerDepositorInserttTA2
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSH1/M-FGFR1-Fv-Fvls-E
Plasmid#15285DepositorInsertFGFR1 kinase, FKBP12v36 (Fgfr1 Mouse)
UseTagsHA epitope and Myristoylation-targeting domain c-…ExpressionMammalianMutationFGFR1 cytoplasmic domain FKBP12 F36VPromoterAvailable sinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphai1-RLuc8
Plasmid#140973PurposeEncodes a G alpha subunit (GNAl1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai1-RLuc8 (GNAI1 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRY2high-mCherry-Raf1
Plasmid#104064PurposeExpresses fusion of CRY2high mutant (CRY2PHR E490R) with mCherry and Raf1DepositorUseTagsExpressionMammalianMutationCRY2PHR E490RPromoterCMVAvailable sinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-AREG-ScNeo
Plasmid#209897PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertAREG-ScNeo (AREG Human)
UseLentiviralTagsmNeonGreen and mScarletExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-PLXNB2-shRNA1
Plasmid#98399PurposeLentivirus for expression of shRNA1 against human PLEXIN-B2 (Dox-inducible)DepositorInsertPlexin-B2 (PLXNB2 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EPGN-ScNeo
Plasmid#209899PurposeTo monitor the status of Epigen, the plasmid encodes a recombinant Epigen fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEPGN-ScNeo (EPGN Human)
UseLentiviralTagsmNeonGreen and mScarletExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EGF-ScNeo
Plasmid#209893PurposeTo monitor the status of EGF, the plasmid encodes a recombinant EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEGF-ScNeo (EGF Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-HBEGF-ScNeo
Plasmid#209894PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertHBEGF-ScNeo (HBEGF Human)
UseLentiviralTagsmNeonGreen and mScarletExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EREG-ScNeo
Plasmid#209896PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Beta1
Plasmid#140987PurposeEncodes a Gbeta subunit (GNB1) as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGBeta1 (GNB1 Human)
UseTagsExpressionMammalianMutationContains an N-terminal human rhinovirus (HRV) 3C …PromoterCMVAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma5-GFP2
Plasmid#166777PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma5-GFP2 (GNG5 Human, Synthetic)
UseTagsExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable sinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma4-GFP2
Plasmid#166776PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma4-GFP2 (GNG4 Human, Synthetic)
UseTagsExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable sinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GGamma10-GFP2
Plasmid#166779PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma10-GFP2 (GNG10 Human, Synthetic)
UseTagsExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable sinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NUP98a_IDR-EGFP
Plasmid#232766PurposeExpresses dCas9-NUP98a_IDR-EGFPDepositorInsertdCas9-NUP98a_IDR-EGFP (NUP98 Human)
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationG44SPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-IDH1-R132H-FLAG
Plasmid#66803PurposeTet-inducible expression of mutant IDH1 in mammalian cells, 3rd generation lentiviral vectorDepositorInsertIDH1 (IDH1 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationR132HPromoterCMVAvailable sinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGS_128
Plasmid#160651PurposeExpresses Human APOE3 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoterDepositorInsertApolipoprotein E e3 (APOE Human)
UseTagsKar2 signal sequenceExpressionYeastMutatione3 allelePromoterpZ estradiol inducible promoterAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianMutationPromoterAvailable sinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only