We narrowed to 21,400 results for: nar;
-
Plasmid#125213PurposeArtificial phase 2 exon to include a spliced T2A-GAL4 effector into a locus of interest through RMCE of MiMIC insertion in an intron between coding exons of a geneDepositorInsertGAL4
UseOtherTagsT2AAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
GST TopBP1 B (aa 978-1192)
Plasmid#20372DepositorAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pFUS_A
Plasmid#31028DepositorInsertLacZ + BsaI restriction sites
Available SinceJune 30, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJEC581
Plasmid#174369PurposeRFP reporter used to evaluate CRISPRa in bacteria, contains gRNA target sites every 10 bp upstream of the promoter.DepositorInsertRFP with PAM rich sequence upstream promoter
UseSynthetic BiologyExpressionBacterialPromoterJ23117Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNG1
Plasmid#30985DepositorInsertrepeat NG1
Available SinceJune 30, 2011AvailabilityAcademic Institutions and Nonprofits only -
GST TopBP1 D (aa 1-1013)
Plasmid#20374DepositorAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEF-BE4Gam
Plasmid#138269PurposeExpression of BE4am-Cas9 Base-editor from an EF1a promoter.DepositorInsertBE4Gam
UseCRISPRExpressionMammalianMutationD10APromoterEf1aAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB1H2w2-12-C81S
Plasmid#18042DepositorInsertHhaI C81S mutant
ExpressionBacterialMutationSimply used as an insert to drop out between Kpn1…Available SinceJune 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pB1H2w2-12-Oct1
Plasmid#18041DepositorInsertHD of Oct1
ExpressionBacterialMutationthe homeodomain of Oct1 is fused to fingers 1 and…Available SinceJune 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGIGYF_AH
Plasmid#148918PurposeInsect Expression of DmGIGYFDepositorInsertDmGIGYF (Gyf Fly)
ExpressionInsectMutationone silent mutation compared to the sequence give…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNUT3
Plasmid#175744PurposeSingle-component photo-inducible (CRY2-based) nucleolus-targeting tool 3DepositorInsertmCherry-CRY2PHR-NoLS (human nuclear factor-κB inducing kinase)
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
LoriT
Plasmid#163691PurposeModified L4440 containing now CamR and oriT for conjugationDepositorInsertoriT
ExpressionBacterialAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAID-CMV linearizing in pX330
Plasmid#140609PurposeCrispr/Cas9 plasmid for linearization of pAID-CMVDepositorInsertsgRNA for pAID-EF1a plasmid digestion
UseCRISPRAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCP5
Plasmid#35397DepositorTypeEmpty backboneUseReporterExpressionYeastPromoterGDP promoterAvailable SinceAug. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFUS_A30A
Plasmid#31029DepositorInsertLacZ + BsaI restriction sites
Available SinceJune 30, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSIBR002
Plasmid#177665PurposeSIBR Intron 2 (Int2) interrupts the CDS of FnCas12aDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterlacUV5Available SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH652-RLuc/maxFLuc
Plasmid#29698DepositorInsertFirefly Luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…Available SinceSept. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hU6-mU6-Cre2GO
Plasmid#136907PurposeLentivirus for base editing activatable Cre recombinase expression in mammalian cells. All in one vector with sgCre2GO.DepositorInsertBlasCyGO
UseLentiviralMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPO635
Plasmid#195297PurposepACYC-plac-MycaTnsABC, lac promoter expressing transposase genes TnsABC of McCAST (Tn7575).DepositorInsertTnsABC operon of McCAST (Tn7575)
ExpressionBacterialPromoterIPTG inducible lac promoterAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only