We narrowed to 9,095 results for: PAN
-
Plasmid#231324PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. L1-RSF1010-Gm-par-ELT4; GG assembly from pGQ0015, pOGG009, pNDGG005, pOGG012, and pOGG014, GmRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pNDGG070
Plasmid#231328PurposeBEVA Golden Gate cloning vector; BEVA2.0 Sucrose curable broad host range plasmid . L1-pBBR1-Sp-sacB-ELT4; GG assembly from pOGG004, pNDGG002, pOGG011, pNDGG008, and pOGG014, SpRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG049
Plasmid#231318PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. -pBBR1-Gm-par-ELT4; GG assembly from pOGG004, pOGG009, pOGG011, pOGG012, and pOGG014, GmRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG021
Plasmid#231305PurposeVector part for BEVA; BEVA2.0 Position 1 Level 1 BsaI cloning site without T0, AmpRDepositorInsertBEVA2.0 Position 1 Level 1 BsaI cloning site without T0, AmpR
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG008
Plasmid#231312PurposeVector part for BEVA; BEVA2.0 Position 4 sacB sucrose counterselection module, AmpR.DepositorInsertBEVA2.0 Position 4 sacB sucrose counterselection module, AmpR.
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQGG002
Plasmid#231329PurposeBEVA Golden Gate cloning vector; BEVA2.0 Narrow host range plasmid with I-SceI counterselectable site. L1-P15A-Nm-ISceI; GG assembly from pOGG004, pNDGG001, pNDGG006, pGQ0023, pOGG014. KmR/NmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_AAN_4
Plasmid#231415PurposeThis AND-AND-NOT-gate plasmid expresses dCas9 from a constitutive promoter. Its sgRNAs X & Y are repressible by sgRNAs A & B, respectively. Its GFP gene is repressible by any of sgRNAs X, Y, and C.DepositorInsertsdCas9
GFP
sgRNA-X
sgRNA-Y
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA498
Plasmid#231119PurposeFragmid fragment: (guide cassette) ABE activity-based selection CD274 positive controlDepositorInsertsgCD274 + ABE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA505
Plasmid#231120PurposeFragmid fragment: (guide cassette) CBE activity-based selection CD274 positive controlDepositorInsertsgCD274 + CBE splice-targeting sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pACEBac1_Strep-Psc-BICD2
Plasmid#228829PurposeInsect cell expression of BICD2DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK468 (BSD-P2A-mAID-dTAG)
Plasmid#214394PurposemAID-dTAG for N-terminal taggingDepositorInsertBSD-P2A-mAID-dTAG
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK452 (BSD-P2A-dTAG-mClover)
Plasmid#214382PurposedTAG-mClover for N-terminal taggingDepositorInsertBSD-P2A-dTAG-mClover
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_T7_gfp
Plasmid#212136PurposeCargo plasmid for integrating PT7 expression cassette of green fluorescent protein in genome.Plasmid can be removed by incubating cells at 37 C.DepositorInsertgreen fluorescent protein
ExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_T7_CbFDH
Plasmid#212140PurposeCargo plasmid for integrating PT7 expression cassette of formate dehydrogenase in genome. Plasmid can be removed by incubating cells at 37 C.DepositorInsertformate dehydrogenase
ExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.1
Plasmid#208306PurposeExpresses ABE-RA4.1 in mammalian cellsDepositorInsertTadA-RA4.1-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.3
Plasmid#208308PurposeExpresses ABE-RA4.3 in mammalian cellsDepositorInsertTadA-RA4.3-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only