We narrowed to 7,657 results for: Cit
-
Plasmid#170217PurposeBarcoded lentiviral vector to express Caspase8 (C360A) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
CALCR-bio-His
Plasmid#53412PurposeExpresses full-length Calcitonin receptor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertCALCR (CALCR Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT5T_hp53_ST_CR2
Plasmid#34923DepositorInsertp53 DNA-binding (Res 94-358, deletion 293-321) (TP53 Human)
ExpressionBacterialMutationC135V, C141V, W146Y, C182S, V203A, R209P, C229Y, …PromoterT7Available SinceFeb. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SRC-1/1-IS2/2
Plasmid#91251PurposeProtein expression and purification of human SH3 domain construct SRC-1/1-IS2/2DepositorInsertSRC-1/1-IS2/2 (SRC Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE4567
Plasmid#107557PurposeExpresses human codon optimized inactive MbCpf1(dead2) in mammalian cells.DepositorInserthMbCpf1(dead2)
Tags3xHA and NLSExpressionMammalianMutationE1080APromoterCMVAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_ERalpha(Y537S)-P2A-Hygro_Barcode
Plasmid#170225PurposeBarcoded lentiviral vector to express ERalpha (Y537S) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-R514G-YFP
Plasmid#29616DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_ITSN1-2/5
Plasmid#91385PurposeProtein expression and purification of human SH3 domain construct ITSN1-2/5DepositorInsertITSN1-2/5 (ITSN1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_LASP1-1/1-SV1/2
Plasmid#91399PurposeProtein expression and purification of human SH3 domain construct LASP1-1/1-SV1/2DepositorInsertLASP1-1/1-SV1/2 (LASP1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-pax3a-kcnj13-IRES-EGFP
Plasmid#164950PurposeTol2 construct: pax3a-5.4k promoter driven zebrafish kcnj13 fused with EGFP and EGFPDepositorInsertkcnj13 (kcnj13 Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPPromoterpax3a promoter -5.4kAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-actinb-kcnj13-IRES-EGFP
Plasmid#164941PurposeTol2 construct: actinb (actb2) promoter driven zebrafish kcnj13 and EGFPDepositorInsertkcnj13 (kcnj13 Zebrafish)
UseTol2 transposon destination vectorTagsIRES-EGFPPromoteractinb (actb2) promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
DLG3_PDZ_3
Plasmid#103948PurposeProtein expression and purification of NE-DLG PDZ3 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_CDK6-P2A-Hygro_Barcode
Plasmid#170224PurposeBarcoded lentiviral vector to express CDK6 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (P to A)
Plasmid#62069PurposeExpression of human p53 (1-73) (all P to A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; all Prolines changed …PromoterT7Available SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_GRB2-2/2
Plasmid#91410PurposeProtein expression and purification of human SH3 domain construct GRB2-2/2DepositorInsertGRB2-2/2 (GRB2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_GRAP2-2/2
Plasmid#91368PurposeProtein expression and purification of human SH3 domain construct GRAP2-2/2DepositorInsertGRAP2-2/2 (GRAP2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_EPS8L2-1/1
Plasmid#91526PurposeProtein expression and purification of human SH3 domain construct EPS8L2-1/1DepositorInsertEPS8L2-1/1 (EPS8L2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PTPN13_PDZ_3
Plasmid#103900PurposeProtein expression and purification of PTPN13 PDZ3 domainDepositorAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only