We narrowed to 17,740 results for: sgRNA
-
Plasmid#218186PurposeTo tag Hevin with mCherry at the N-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-4)-PGKpuroBFP-W
Plasmid#211986PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-5)-PGKpuroBFP-W
Plasmid#211987PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMM725
Plasmid#68895PurposeIPTG-inducible CRISPRi vector targeting NanoLuc (NL3), constiutive NanoLuc, pNBU2 backbone, AmpRDepositorInsertsdCas9
LacI
sgRNA
NanoLuc
Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAK010
Plasmid#128227Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 4DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 4
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK011
Plasmid#128228Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 5DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 5
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK012
Plasmid#128229Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 6DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 6
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH87
Plasmid#128200PurposesgRNA backbone for StCas9, combine with TaU3 promoter module (pFH33)DepositorInsertsgRNA backbone for StCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
RUBY-ABE#2
Plasmid#232176PurposeT-DNA vector with ecTadA8e-zCas9D10A and corresponding sgRNA to correct RUBYm2 and recover a vivid red color visible to the naked eyes.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-sgRNA-mis4-gRNA scaffold
UseCRISPRTags3xflag and NLSExpressionPlantAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1
Plasmid#233078PurposeExpression vector for sgRNA-S1b and eCas12f1DepositorInsertU6-sgRNA-S1b (BsaI)-CBh-bpNLS-eCas12f1-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
px330-Pten-2
Plasmid#162552PurposesgRNA targeting PtenDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T2_gRNA
Plasmid#197647PurposepDEL160; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type II sgRNADepositorInsertszCREST3
Cas9
nrg1 type II sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T1_gRNA
Plasmid#199332PurposepDEL159; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type I sgRNADepositorInsertszCREST3
Cas9
nrg1 type I sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-BbsI-CMV-EGFP cloning vector
Plasmid#239464PurposesgRNA cloning vector with EGFP expression cassette. An sgRNA spacer sequence can be cloned into BbsI sites. A CMV-EGFP expression cassette is included as a reporter of transfection efficiency.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterU6 promoterAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA3
Plasmid#164929PurposeExpresses Non-targeting sgRNA3 control in mammalian cellsDepositorInsertNon-targeting sgRNA3 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsNot1_AH
Plasmid#148856PurposeMammalian Expression of HsNot1-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 V2102I
Plasmid#139322PurposePlasmid expressing a sgRNA to introduce BRCA2 V2102I using base editingDepositorInsertsgRNA to insert BRCA2 V2102I using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 E2772K
Plasmid#139323PurposePlasmid expressing a sgRNA to introduce BRCA2 E2772K using base editingDepositorInsertsgRNA to insert BRCA2 E2772K using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only