Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pgRNA-guideless
(Plasmid #129464)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129464 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSCrhaB2
  • Backbone manufacturer
    Miguel Valvano and Silvia Cardona
  • Backbone size w/o insert (bp) 5451
  • Total vector size (bp) 5581
  • Modifications to backbone
    pSCB2-sgRNA is the actual vector backbone. Rhamnose-inducible promoter system removed via inverse PCR. Additional inverse PCR removal of 20 nucleotide target. Negative control, incapable of binding to chromosome.
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Trimethoprim
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Guideless gRNA backbone
  • gRNA/shRNA sequence
    N/A
  • Species
    Synthetic
  • GenBank ID
    MH319949.1
  • Promoter BBa_J23119 (SpeI)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAAGATggatccTCAGTTGGCTTCATCGCTAC
  • 3′ sequencing primer CCGCCAGGCAAATTCTGTTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    gRNA scaffold used in construction of pgRNA-bacteria from Qi et al. (2013).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pgRNA-guideless was a gift from Silvia Cardona (Addgene plasmid # 129464 ; http://n2t.net/addgene:129464 ; RRID:Addgene_129464)
  • For your References section:

    A broad-host-range CRISPRi toolkit for silencing gene expression in Burkholderia. Hogan AM, Rahman ASMZ, Lightly TJ, Cardona ST. ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232. 10.1021/acssynbio.9b00232 PubMed 31491085