Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAH-CTX1-rhadCas9-native
(Plasmid #129392)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 129392 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAH-CTX1-rha
  • Backbone manufacturer
    Andrew Hogan
  • Backbone size w/o insert (bp) 7649
  • Total vector size (bp) 11897
  • Modifications to backbone
    Insertion of Streptococcus pyogenes dCas9
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S. pyogenes dCas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4248
  • Mutation
    Aspartate 10 to Alanine, Histidine 840 to Alanine
  • GenBank ID
    AE004092.2
  • Promoter PrhaBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGGTTCTATCGCCACGGAC
  • 3′ sequencing primer CTTCCGCTGTCTCTCCACTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    dCas9 designed for S. pyogenes was cloned by Qi et al. (2013). The plasmid, 44249, was distributed by Addgene.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAH-CTX1-rhadCas9-native was a gift from Silvia Cardona (Addgene plasmid # 129392 ; http://n2t.net/addgene:129392 ; RRID:Addgene_129392)
  • For your References section:

    A broad-host-range CRISPRi toolkit for silencing gene expression in Burkholderia. Hogan AM, Rahman ASMZ, Lightly TJ, Cardona ST. ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232. 10.1021/acssynbio.9b00232 PubMed 31491085