We narrowed to 6,269 results for: pAAV
-
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only
-
AiP1890 - pAAV-AiE2577m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214571PurposeAiE2577m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1930 - pAAV-AiE2357m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214584PurposeAiE2357m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1412 - pAAV-AiE2183m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214490PurposeAiE2183m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1725 - pAAV-AiE2394m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214528PurposeAiE2394m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1762 - pAAV-AiE2344m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214538PurposeAiE2344m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1531 - pAAV-AiE2036m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214505PurposeAiE2036m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1426 - pAAV-AiE2133m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214496PurposeAiE2133m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1513 - pAAV-AiE2192m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214503PurposeAiE2192m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1668 - pAAV-AiE2347m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214513PurposeAiE2347m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1850 - pAAV-AiE2529m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214553PurposeAiE2529m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1432 - pAAV-AiE2144m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214498PurposeAiE2144m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1424 - pAAV-AiE2131m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214494PurposeAiE2131m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1882 - pAAV-AiE2464m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214568PurposeAiE2464m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1878 - pAAV-AiE2425m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214566PurposeAiE2425m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1690 - pAAV-AiE2365m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214517PurposeAiE2365m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1844 - pAAV-AiE2474m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214549PurposeAiE2474m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1970 - pAAV-AiE2585m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214598PurposeAiE2585m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1895 - pAAV-AiE2583m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214574PurposeAiE2583m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only