We narrowed to 24,898 results for: Spr
-
Plasmid#90902Purpose3rd generation lentiviral gRNA plasmid targeting human SRSF2DepositorInsertSRSF2 (Guide Designation A9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
SRSF2 A10.3 gRNA
Plasmid#90903Purpose3rd generation lentiviral gRNA plasmid targeting human SRSF2DepositorInsertSRSF2 (Guide Designation A10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
LIN52 D5.4 gRNA
Plasmid#90734Purpose3rd generation lentiviral gRNA plasmid targeting human LIN52DepositorInsertLIN52 (Guide Designation D5.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX330_MED13_iso1_1
Plasmid#135751PurposeEncodes gRNA for 3' target of human MED13_iso1DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB3053(gRNA X-2, XI-5, XII-4)
Plasmid#73295PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-2, XI-5, and XII-4DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0001
Plasmid#42241PurposegRNA targeted to zebrafish gene apoeaDepositorAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
PPP2R5C B11.5 gRNA
Plasmid#90853Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R5CDepositorInsertPPP2R5C (Guide Designation B11.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
TUBB F2.4 gRNA
Plasmid#90925Purpose3rd generation lentiviral gRNA plasmid targeting human TUBBDepositorInsertTUBB (Guide Designation F2.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
NUMA1 H11.2 gRNA
Plasmid#90808Purpose3rd generation lentiviral gRNA plasmid targeting human NUMA1DepositorInsertNUMA1 (Guide Designation H11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18
Plasmid#172317PurposeCRISPR dCas9 directly fused to a catalytic inactive version of bacterial DNA methyltransferase MQ1 to target to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(C141S,S317A)_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0173_Cq-Actin5c-Cas9
Plasmid#169345PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0173_Cq-Actin5c-Cas9
UseCRISPRExpressionInsectPromoterCPIJ009808Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
NUMA1 H12.2 gRNA
Plasmid#90809Purpose3rd generation lentiviral gRNA plasmid targeting human NUMA1DepositorInsertNUMA1 (Guide Designation H12.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVMG0212_Cq-nanos-Cas9
Plasmid#169348PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0212_Cq-nanos-Cas9
UseCRISPRExpressionInsectPromoterCPIJ011551Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVMG0213_Cq-vasa-Cas9
Plasmid#169347PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0213_Cq-vasa-Cas9
UseCRISPRExpressionInsectPromoterCPIJ009286Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
CDC6 B5.1 gRNA
Plasmid#90596Purpose3rd generation lentiviral gRNA plasmid targeting human CDC6DepositorInsertCDC6 (Guide Designation B5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
KMT5A H2.3 gRNA
Plasmid#90727Purpose3rd generation lentiviral gRNA plasmid targeting human KMT5ADepositorInsertKMT5A (Guide Designation H2.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
UNG D12.3 gRNA
Plasmid#90937Purpose3rd generation lentiviral gRNA plasmid targeting human UNGDepositorInsertUNG (Guide Designation D12.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
PRC1 G2.2 gRNA
Plasmid#90857Purpose3rd generation lentiviral gRNA plasmid targeting human PRC1DepositorInsertPRC1 (Guide Designation G2.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
PRC1 G1.2 gRNA
Plasmid#90856Purpose3rd generation lentiviral gRNA plasmid targeting human PRC1DepositorInsertPRC1 (Guide Designation G1.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only